Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0029502

Physical Location & Seq

Genomic Coordinates Reverse (-)

57704043 .. 57707014

Gene Structure 2972 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ40213

Sequence Viewer

CDS Protein Promoter (2k)

Length: 126 bp

ATGTTGTTGCTTGGGACTCAAGTCTTCCATTGCAATGTTGATTCTTCTGGTAATGTAAGTTTGGAAATCGTAAAGGATGGTTGGAGTCCAGCTCTAACGATTACAAAGGTGCTACTAGCAATTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004842 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0010099 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0032446 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0048580 GO:0048583 GO:0050789 GO:0050793 GO:0051239 GO:0065007 GO:0070647 GO:0071704 GO:0140096 GO:1901564 GO:2000026 GO:2000030

KEGG Pathways

Metabolic & Signaling

ko04120 map04120

Pfam Domains

Protein Families

UQ_con

Protein Analysis

41

Amino Acids

4.38

Weight (kDa)

5.36

Isoelectric Point (pI)

25.94

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
UQ_con	PF00179	6 - 41	2.5e-10	Ubiquitin-conjugating enzyme

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029502)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr0c11g0499421 RchiOBHm_Chr4g0433661

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	1 cut(s)	92
AluI	AGCT	1 cut(s)	92
BbsI	GAAGAC	1 cut(s)	16
BccI	CCATC	1 cut(s)	71
BfaI	CTAG	1 cut(s)	116
BoxI	GACNNNNGTC	1 cut(s)	20
BpiI	GAAGAC	1 cut(s)	16
BplI	GAGNNNNNCTC	2 cut(s)	76, 108
Bse3DI	GCAATG	2 cut(s)	28, 40
BseGI	GGATG	1 cut(s)	82
BseMI	GCAATG	2 cut(s)	28, 40
BslFI	GGGAC	1 cut(s)	28
BsmFI	GGGAC	1 cut(s)	28
BsrDI	GCAATG	2 cut(s)	28, 40
BstF5I	GGATG	1 cut(s)	82
BstPAI	GACNNNNGTC	1 cut(s)	20
BstV2I	GAAGAC	1 cut(s)	16
BtsCI	GGATG	1 cut(s)	82
CviJI	RGCY	1 cut(s)	92
CviKI_1	RGCY	1 cut(s)	92
FaqI	GGGAC	1 cut(s)	28
FokI	GGATG	1 cut(s)	89
FspBI	CTAG	1 cut(s)	116
FspEI	CC	8 cut(s)	33, 41, 47, 59, 63, 67, 92, 102
HinfI	GANTC	3 cut(s)	16, 41, 85
HpyCH4V	TGCA	1 cut(s)	33
LpnPI	CCDG	2 cut(s)	33, 102
MaeI	CTAG	1 cut(s)	116
MboII	GAAGA	2 cut(s)	16, 36
MluCI	AATT	1 cut(s)	120
MlyI	GAGTC	2 cut(s)	10, 94
MmeI	TCCRAC	1 cut(s)	62
MslI	CAYNNNNRTG	1 cut(s)	33
PfeI	GAWTC	1 cut(s)	41
PleI	GAGTC	2 cut(s)	10, 93
PpsI	GAGTC	2 cut(s)	10, 93
PshAI	GACNNNNGTC	1 cut(s)	20
RseI	CAYNNNNRTG	1 cut(s)	33
SchI	GAGTC	2 cut(s)	10, 94
SetI	ASST	2 cut(s)	94, 111
SgeI	CNNG	4 cut(s)	23, 32, 60, 101
SmiMI	CAYNNNNRTG	1 cut(s)	33
SmlI	CTYRAG	1 cut(s)	18
SmoI	CTYRAG	1 cut(s)	18
Sse9I	AATT	1 cut(s)	120
SspMI	CTAG	1 cut(s)	116
TasI	AATT	1 cut(s)	120
TfiI	GAWTC	1 cut(s)	41
XspI	CTAG	1 cut(s)	116

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.