RchiOBHm_Chr1g0313391

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
470741 .. 470972
232 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54421

Sequence Viewer

Length: 159 bp
ATGTGTGAGTGCTACATCCATGGAAATACTACTAAGTATCTGCAAGTTCCTGATGGGGTAGTTCCTAGTGGCGTTGCCCTTGTATATCAGGAGATTGAGCAGCAAAGAGAACTAGATGATTTGGTATATATTTTCAGATTATGTGGGTTTAAATTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.0

Weight (kDa)

4.7

Isoelectric Point (pI)

45.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029598)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0313391 RchiOBHm_Chr3g0494651

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
ApeKI GCWGC 1 cut(s) 100
BbvI GCAGC 1 cut(s) 112
BccI CCATC 1 cut(s) 47
BfaI CTAG 2 cut(s) 66, 113
BisI GCNGC 1 cut(s) 101
BlsI GCNGC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 19
BseGI GGATG 1 cut(s) 15
BseXI GCAGC 1 cut(s) 112
Bsp19I CCATGG 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 19
BssT1I CCWWGG 1 cut(s) 19
BstDEI CTNAG 1 cut(s) 33
BstDSI CCRYGG 1 cut(s) 19
BstF5I GGATG 1 cut(s) 15
BstV1I GCAGC 1 cut(s) 112
BtgI CCRYGG 1 cut(s) 19
BtsCI GGATG 1 cut(s) 15
CviAII CATG 1 cut(s) 20
DdeI CTNAG 1 cut(s) 33
DraI TTTAAA 1 cut(s) 151
Eco130I CCWWGG 1 cut(s) 19
EcoT14I CCWWGG 1 cut(s) 19
ErhI CCWWGG 1 cut(s) 19
FaeI CATG 1 cut(s) 23
FaiI YATR 5 cut(s) 21, 85, 127, 129, 142
FatI CATG 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 101
FokI GGATG 1 cut(s) 2
Fsp4HI GCNGC 1 cut(s) 101
FspBI CTAG 2 cut(s) 66, 113
GluI GCNGC 1 cut(s) 101
Hin1II CATG 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 137
Hpy188III TCNNGA 2 cut(s) 50, 89
HpyCH4V TGCA 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 1 cut(s) 23
LpnPI CCDG 2 cut(s) 63, 74
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 2 cut(s) 66, 113
MluCI AATT 1 cut(s) 152
MseI TTAA 1 cut(s) 150
NcoI CCATGG 1 cut(s) 19
NlaIII CATG 1 cut(s) 23
PkrI GCNGC 1 cut(s) 102
SaqAI TTAA 1 cut(s) 150
SatI GCNGC 1 cut(s) 101
SgeI CNNG 7 cut(s) 32, 56, 62, 78, 92, 101, 125
Sse9I AATT 1 cut(s) 152
SspMI CTAG 2 cut(s) 66, 113
StyI CCWWGG 1 cut(s) 19
TasI AATT 1 cut(s) 152
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TseI GCWGC 1 cut(s) 100
XspI CTAG 2 cut(s) 66, 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.