RchiOBHm_Chr3g0494651

U6 snRNA-associated Sm-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
43473273 .. 43474249
977 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45717

Sequence Viewer

Length: 258 bp
ATGCATTTTAGTTGGCTTTTAGCCTTTCTGGACATCTCTTGTTTCCTTCCTATTTCAGTCAAACTTAAGATCATTTATTGCAGTTCGTCTGATGAATCTTGCCACCTTGCATTGATCTCCATATTAGATACAGATGGAGACAGGTTTTGGAGGATGCGTGAGTGCTACATCCATGGAAATACTACTAAGTATCTGCGAGTTCCTGATGGGGTAGTTCCTAGTGTCATTGCCCTTGTATATCAGGTGATTGAGCAGTAA

Protein Analysis

85

Amino Acids

9.78

Weight (kDa)

5.79

Isoelectric Point (pI)

50.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029598)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0313391 RchiOBHm_Chr3g0494651

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 256
BccI CCATC 2 cut(s) 128, 200
BcoDI GTCTC 1 cut(s) 132
BfaI CTAG 1 cut(s) 219
BfrI CTTAAG 1 cut(s) 65
BmsI GCATC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 172
BsaXI ACNNNNNCTCC 2 cut(s) 142, 172
Bse3DI GCAATG 1 cut(s) 225
BseDI CCNNGG 1 cut(s) 172
BseGI GGATG 2 cut(s) 159, 168
BseMI GCAATG 1 cut(s) 225
BsmAI GTCTC 1 cut(s) 132
Bsp143I GATC 2 cut(s) 69, 114
Bsp19I CCATGG 1 cut(s) 172
BspTI CTTAAG 1 cut(s) 65
BsrDI GCAATG 1 cut(s) 225
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 2 cut(s) 69, 114
BssT1I CCWWGG 1 cut(s) 172
BstAFI CTTAAG 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 186
BstDSI CCRYGG 1 cut(s) 172
BstF5I GGATG 2 cut(s) 159, 168
BstKTI GATC 2 cut(s) 72, 117
BstMAI GTCTC 1 cut(s) 132
BstMBI GATC 2 cut(s) 69, 114
BtgI CCRYGG 1 cut(s) 172
BtsCI GGATG 2 cut(s) 159, 168
CviAII CATG 1 cut(s) 173
CviJI RGCY 2 cut(s) 16, 23
CviKI_1 RGCY 2 cut(s) 16, 23
DdeI CTNAG 1 cut(s) 186
DpnI GATC 2 cut(s) 71, 116
DpnII GATC 2 cut(s) 69, 114
Eco130I CCWWGG 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 172
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 1 cut(s) 176
FaiI YATR 3 cut(s) 122, 174, 238
FatI CATG 1 cut(s) 172
FokI GGATG 2 cut(s) 155, 166
FspBI CTAG 1 cut(s) 219
Hin1II CATG 1 cut(s) 176
HinfI GANTC 1 cut(s) 95
HphI GGTGA 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 29, 203
HpyAV CCTTC 1 cut(s) 56
HpyCH4V TGCA 3 cut(s) 4, 81, 110
HpyF3I CTNAG 1 cut(s) 186
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 2 cut(s) 69, 114
LpnPI CCDG 4 cut(s) 14, 127, 216, 227
LweI GCATC 1 cut(s) 144
MaeI CTAG 1 cut(s) 219
MalI GATC 2 cut(s) 71, 116
MboI GATC 2 cut(s) 69, 114
MnlI CCTC 1 cut(s) 144
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 66
MspCI CTTAAG 1 cut(s) 65
NcoI CCATGG 1 cut(s) 172
NdeII GATC 2 cut(s) 69, 114
NlaIII CATG 1 cut(s) 176
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 66
Sau3AI GATC 2 cut(s) 69, 114
SetI ASST 3 cut(s) 108, 146, 246
SfaNI GCATC 1 cut(s) 144
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
SspMI CTAG 1 cut(s) 219
StyI CCWWGG 1 cut(s) 172
TfiI GAWTC 1 cut(s) 95
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TspDTI ATGAA 1 cut(s) 108
Vha464I CTTAAG 1 cut(s) 65
XspI CTAG 1 cut(s) 219
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.