Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0029699

Physical Location & Seq

Genomic Coordinates Reverse (-)

8657045 .. 8660858

Gene Structure 3814 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ55122

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGGACCCAAAAGCCGTGAAATCGGACCTAGTCCTCATCCTCGACTACGGCTCCCAATACACCCACCTCATCGCTCGCCGCATCCGATCCCTCTCCGTCTTCTACCTCACCATCTTCAGCACCAGCCCCCTCAAGCCCATCACATGGAGACAAATTGGGTTTAAACCCCAGAGTAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0003921 GO:0003922 GO:0006139 GO:0006163 GO:0006164 GO:0006177 GO:0006725 GO:0006753 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009058 GO:0009116 GO:0009117 GO:0009119 GO:0009123 GO:0009124 GO:0009126 GO:0009127 GO:0009150 GO:0009152 GO:0009156 GO:0009161 GO:0009163 GO:0009165 GO:0009167 GO:0009168 GO:0009259 GO:0009260 GO:0009987 GO:0016874 GO:0016879 GO:0016884 GO:0018130 GO:0019438 GO:0019637 GO:0019693 GO:0034404 GO:0034641 GO:0034654 GO:0042278 GO:0042451 GO:0042455 GO:0044237 GO:0044238 GO:0044249 GO:0044271 GO:0044281 GO:0044283 GO:0046037 GO:0046128 GO:0046129 GO:0046390 GO:0046483 GO:0055086 GO:0071704 GO:0072521 GO:0072522 GO:0090407 GO:1901068 GO:1901070 GO:1901135 GO:1901137 GO:1901293 GO:1901360 GO:1901362 GO:1901564 GO:1901566 GO:1901576 GO:1901657 GO:1901659

KEGG Pathways

Metabolic & Signaling

ko00230 ko00983 ko01100 map00230 map00983 map01100

Pfam Domains

Protein Families

GATase GMP_synt_C NAD_synthase

Protein Analysis

59

Amino Acids

6.81

Weight (kDa)

10.11

Isoelectric Point (pI)

46.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029699)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0321151 RchiOBHm_Chr7g0219111

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	144
AciI	CCGC	1 cut(s)	79
AclWI	GGATC	1 cut(s)	81
AcuI	CTGAAG	1 cut(s)	100
AfiI	CCNNNNNNNGG	1 cut(s)	144
Alw26I	GTCTC	1 cut(s)	142
AlwI	GGATC	1 cut(s)	81
AspS9I	GGNCC	2 cut(s)	4, 25
AsuHPI	GGTGA	1 cut(s)	100
AvaII	GGWCC	2 cut(s)	4, 25
BbsI	GAAGAC	1 cut(s)	91
BccI	CCATC	2 cut(s)	119, 146
BceAI	ACGGC	1 cut(s)	64
BcoDI	GTCTC	1 cut(s)	142
BfaI	CTAG	1 cut(s)	29
BisI	GCNGC	1 cut(s)	79
BlsI	GCNGC	1 cut(s)	80
Bme18I	GGWCC	2 cut(s)	4, 25
BmgT120I	GGNCC	2 cut(s)	4, 25
BmiI	GGNNCC	2 cut(s)	6, 52
BmsI	GCATC	1 cut(s)	90
BpiI	GAAGAC	1 cut(s)	91
BpuEI	CTTGAG	1 cut(s)	116
BsaXI	ACNNNNNCTCC	2 cut(s)	35, 65
Bsc4I	CCNNNNNNNGG	1 cut(s)	144
BseGI	GGATG	2 cut(s)	36, 81
BseLI	CCNNNNNNNGG	1 cut(s)	144
BslI	CCNNNNNNNGG	1 cut(s)	144
BsmAI	GTCTC	1 cut(s)	142
Bsp143I	GATC	1 cut(s)	86
BspACI	CCGC	1 cut(s)	79
BspLI	GGNNCC	2 cut(s)	6, 52
BspPI	GGATC	1 cut(s)	81
BssMI	GATC	1 cut(s)	86
BstC8I	GCNNGC	1 cut(s)	76
BstF5I	GGATG	2 cut(s)	36, 81
BstKTI	GATC	1 cut(s)	89
BstMAI	GTCTC	1 cut(s)	142
BstMBI	GATC	1 cut(s)	86
BstV2I	GAAGAC	1 cut(s)	91
BtgZI	GCGATG	1 cut(s)	55
BtsCI	GGATG	2 cut(s)	36, 81
Cac8I	GCNNGC	1 cut(s)	76
Cfr13I	GGNCC	2 cut(s)	4, 25
CviAII	CATG	1 cut(s)	144
CviJI	RGCY	4 cut(s)	14, 51, 126, 136
CviKI_1	RGCY	4 cut(s)	14, 51, 126, 136
DpnI	GATC	1 cut(s)	88
DpnII	GATC	1 cut(s)	86
DraI	TTTAAA	1 cut(s)	163
Eco47I	GGWCC	2 cut(s)	4, 25
Eco57I	CTGAAG	1 cut(s)	100
FaeI	CATG	1 cut(s)	147
FaiI	YATR	1 cut(s)	145
FatI	CATG	1 cut(s)	143
Fnu4HI	GCNGC	1 cut(s)	79
FokI	GGATG	2 cut(s)	23, 68
Fsp4HI	GCNGC	1 cut(s)	79
FspBI	CTAG	1 cut(s)	29
GluI	GCNGC	1 cut(s)	79
Hin1II	CATG	1 cut(s)	147
HphI	GGTGA	1 cut(s)	100
Hpy188I	TCNGA	2 cut(s)	25, 86
Hsp92II	CATG	1 cut(s)	147
Kzo9I	GATC	1 cut(s)	86
LmnI	GCTCC	1 cut(s)	56
LpnPI	CCDG	1 cut(s)	136
LweI	GCATC	1 cut(s)	90
MaeI	CTAG	1 cut(s)	29
MalI	GATC	1 cut(s)	88
MboI	GATC	1 cut(s)	86
MboII	GAAGA	2 cut(s)	91, 106
MluCI	AATT	2 cut(s)	153, 175
MnlI	CCTC	6 cut(s)	44, 50, 77, 101, 116, 140
MseI	TTAA	1 cut(s)	162
MssI	GTTTAAAC	1 cut(s)	163
NdeII	GATC	1 cut(s)	86
NlaIII	CATG	1 cut(s)	147
NlaIV	GGNNCC	2 cut(s)	6, 52
PcsI	WCGNNNNNNNCGW	1 cut(s)	82
PflFI	GACNNNGTC	1 cut(s)	29
PflMI	CCANNNNNTGG	1 cut(s)	144
PkrI	GCNGC	1 cut(s)	80
PmeI	GTTTAAAC	1 cut(s)	163
PspN4I	GGNNCC	2 cut(s)	6, 52
PspPI	GGNCC	2 cut(s)	4, 25
PsyI	GACNNNGTC	1 cut(s)	29
SaqAI	TTAA	1 cut(s)	162
SatI	GCNGC	1 cut(s)	79
Sau3AI	GATC	1 cut(s)	86
Sau96I	GGNCC	2 cut(s)	4, 25
SetI	ASST	3 cut(s)	30, 69, 108
SfaNI	GCATC	1 cut(s)	90
SgeI	CNNG	7 cut(s)	28, 41, 53, 87, 135, 145, 156
SinI	GGWCC	2 cut(s)	4, 25
SmlI	CTYRAG	1 cut(s)	131
SmoI	CTYRAG	1 cut(s)	131
Sse9I	AATT	2 cut(s)	153, 175
SsiI	CCGC	1 cut(s)	79
SspMI	CTAG	1 cut(s)	29
TaqI	TCGA	1 cut(s)	42
TasI	AATT	2 cut(s)	153, 175
TauI	GCSGC	1 cut(s)	81
Tru1I	TTAA	1 cut(s)	162
Tru9I	TTAA	1 cut(s)	162
TspGWI	ACGGA	1 cut(s)	85
Tth111I	GACNNNGTC	1 cut(s)	29
Van91I	CCANNNNNTGG	1 cut(s)	144
VpaK11BI	GGWCC	2 cut(s)	4, 25
XspI	CTAG	1 cut(s)	29

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.