RchiOBHm_Chr1g0336661

PPR repeat

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
28372140 .. 28372352
213 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56460

Sequence Viewer

Length: 180 bp
ATGGTTTTAACAGCTCTGGCGCAATGTGGGAGGATTGAGGAGGCCAGGAGGCTGTTTTGTTTGATGCCCGAAAGGGATGTTATTTCGTGGACCGCAATGGTTGCGGAGTTTTCAAGAAATGGCAGGATCGATGAAGCTAGAGAAGTTTTTGATAGGATGCCGAGAAGGAATGTGGTGTAG

Protein Analysis

59

Amino Acids

6.91

Weight (kDa)

7.84

Isoelectric Point (pI)

63.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 25 - 58 3.9e-07 PPR repeat family
PPR_1 PF12854 25 - 53 1.4e-06 PPR repeat
PPR PF01535 28 - 58 5e-08 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029528)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0336661
rosa_multiflora Rmu_sc0000907.1_g000006

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 93, 104
AclWI GGATC 1 cut(s) 134
AgsI TTSAA 1 cut(s) 114
AjnI CCWGG 1 cut(s) 44
AluBI AGCT 2 cut(s) 14, 137
AluI AGCT 2 cut(s) 14, 137
AlwI GGATC 1 cut(s) 134
AoxI GGCC 1 cut(s) 42
AspLEI GCGC 1 cut(s) 22
AspS9I GGNCC 1 cut(s) 90
AvaII GGWCC 1 cut(s) 90
BciT130I CCWGG 1 cut(s) 46
BfaI CTAG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 46
Bme18I GGWCC 1 cut(s) 90
BmgT120I GGNCC 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 46
BmsI GCATC 2 cut(s) 54, 147
Bsa29I ATCGAT 1 cut(s) 129
Bse3DI GCAATG 2 cut(s) 29, 102
BseBI CCWGG 1 cut(s) 46
BseCI ATCGAT 1 cut(s) 129
BseGI GGATG 2 cut(s) 82, 162
BseMI GCAATG 2 cut(s) 29, 102
BseRI GAGGAG 1 cut(s) 53
BshFI GGCC 1 cut(s) 44
BshVI ATCGAT 1 cut(s) 129
BsnI GGCC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 126
BspACI CCGC 2 cut(s) 93, 104
BspANI GGCC 1 cut(s) 44
BspDI ATCGAT 1 cut(s) 129
BspPI GGATC 1 cut(s) 134
BsrDI GCAATG 2 cut(s) 29, 102
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 46
BstAPI GCANNNNNTGC 1 cut(s) 101
BstF5I GGATG 2 cut(s) 82, 162
BstHHI GCGC 1 cut(s) 22
BstKTI GATC 1 cut(s) 129
BstMBI GATC 1 cut(s) 126
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
Bsu15I ATCGAT 1 cut(s) 129
BsuRI GGCC 1 cut(s) 44
BsuTUI ATCGAT 1 cut(s) 129
BtsCI GGATG 2 cut(s) 82, 162
CfoI GCGC 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 90
ClaI ATCGAT 1 cut(s) 129
CviJI RGCY 4 cut(s) 14, 44, 52, 137
CviKI_1 RGCY 4 cut(s) 14, 44, 52, 137
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 44
FokI GGATG 2 cut(s) 89, 169
FspBI CTAG 1 cut(s) 138
GlaI GCGC 1 cut(s) 21
HaeIII GGCC 1 cut(s) 44
HhaI GCGC 1 cut(s) 22
Hin6I GCGC 1 cut(s) 20
HinP1I GCGC 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 114
Hpy8I GTNNAC 1 cut(s) 90
HpyAV CCTTC 1 cut(s) 159
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HspAI GCGC 1 cut(s) 20
Kzo9I GATC 1 cut(s) 126
LpnPI CCDG 4 cut(s) 2, 31, 58, 109
LweI GCATC 2 cut(s) 54, 147
MaeI CTAG 1 cut(s) 138
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MnlI CCTC 4 cut(s) 24, 31, 34, 42
MseI TTAA 1 cut(s) 8
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 1 cut(s) 126
Psp6I CCWGG 1 cut(s) 44
PspGI CCWGG 1 cut(s) 44
PspPI GGNCC 1 cut(s) 90
SaqAI TTAA 1 cut(s) 8
Sau3AI GATC 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 90
ScrFI CCNGG 1 cut(s) 46
SetI ASST 2 cut(s) 16, 139
SfaNI GCATC 2 cut(s) 54, 147
SgeI CNNG 9 cut(s) 29, 57, 58, 80, 99, 126, 136, 150, 174
SinI GGWCC 1 cut(s) 90
SsiI CCGC 2 cut(s) 93, 104
SspMI CTAG 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 44
TaqI TCGA 1 cut(s) 129
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 147
VpaK11BI GGWCC 1 cut(s) 90
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.