RchiOBHm_Chr1g0345771
MYB Family

Alcohol dehydrogenase transcription factor Myb/SANT-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
38002838 .. 38003849
1012 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57208

Sequence Viewer

Length: 309 bp
ATGAAGAGTATGCATAAGATGTATAGAAATGGAGTTGGGGGGAGTGGTAAGGGCAGTGTTGGTGGTGGAAGTGGTGGGTTTAGGATTAGGATTCTGACTGGCATTAGTATAGCTCAGCCTGGGAACAAAGTTTATCCGAACATGGATCCGAAATTCGGGTTGAATTCGCATTCGGGGCCGAGTTATACTACTGCTAAGGTGATGAGAGAGTGCAATTATAATTCGGGGGGAGAAGTGGGGGTTGGGGCAGAGGTCGAGGGAAAGAGAGAGGGGGAGAGACCCTGTGGCGGAAATGGTGTCGGCGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

10.49

Weight (kDa)

9.47

Isoelectric Point (pI)

28.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029558)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0345771
rosa_multiflora Rmu_sc0001349.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 219
AciI CCGC 1 cut(s) 288
AclWI GGATC 2 cut(s) 140, 153
AcsI RAATTY 2 cut(s) 152, 163
AfiI CCNNNNNNNGG 2 cut(s) 155, 287
AgsI TTSAA 1 cut(s) 163
AjnI CCWGG 1 cut(s) 118
AjuI GAANNNNNNNTTGG 2 cut(s) 225, 257
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
Alw26I GTCTC 1 cut(s) 271
AlwI GGATC 2 cut(s) 140, 153
AoxI GGCC 1 cut(s) 176
ApoI RAATTY 2 cut(s) 152, 163
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 211
BamHI GGATCC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 271
BlpI GCTNAGC 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 120
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 2 cut(s) 147, 177
BmrFI CCNGG 1 cut(s) 120
Bpu10I CCTNAGC 1 cut(s) 195
Bpu1102I GCTNAGC 1 cut(s) 114
BsaI GGTCTC 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 119
Bsc4I CCNNNNNNNGG 2 cut(s) 155, 287
Bse1I ACTGG 1 cut(s) 103
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 119
BseLI CCNNNNNNNGG 2 cut(s) 155, 287
BseMII CTCAG 1 cut(s) 128
BseNI ACTGG 1 cut(s) 103
BshFI GGCC 1 cut(s) 178
BslI CCNNNNNNNGG 2 cut(s) 155, 287
BsmAI GTCTC 1 cut(s) 271
BsmI GAATGC 1 cut(s) 169
BsnI GGCC 1 cut(s) 178
Bso31I GGTCTC 1 cut(s) 271
Bsp143I GATC 1 cut(s) 145
Bsp1720I GCTNAGC 1 cut(s) 114
BspACI CCGC 1 cut(s) 288
BspANI GGCC 1 cut(s) 178
BspCNI CTCAG 1 cut(s) 127
BspLI GGNNCC 2 cut(s) 147, 177
BspPI GGATC 2 cut(s) 140, 153
BspTNI GGTCTC 1 cut(s) 271
BsrI ACTGG 1 cut(s) 103
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 1 cut(s) 145
Bst2UI CCWGG 1 cut(s) 120
BstDEI CTNAG 2 cut(s) 114, 195
BstKTI GATC 1 cut(s) 148
BstMAI GTCTC 1 cut(s) 271
BstMBI GATC 1 cut(s) 145
BstMWI GCNNNNNNNGC 1 cut(s) 175
BstNI CCWGG 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 118
BstX2I RGATCY 1 cut(s) 145
BstYI RGATCY 1 cut(s) 145
BsuRI GGCC 1 cut(s) 178
BtsI GCAGTG 1 cut(s) 61
BtsIMutI CAGTG 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 176
CviAII CATG 1 cut(s) 142
CviJI RGCY 3 cut(s) 113, 118, 178
CviKI_1 RGCY 3 cut(s) 113, 118, 178
DdeI CTNAG 2 cut(s) 114, 195
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
EciI GGCGGA 1 cut(s) 303
Eco31I GGTCTC 1 cut(s) 271
EcoRI GAATTC 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 118
EcoT22I ATGCAT 1 cut(s) 15
FaeI CATG 1 cut(s) 145
FaiI YATR 7 cut(s) 11, 15, 24, 110, 143, 186, 219
FatI CATG 1 cut(s) 141
HaeIII GGCC 1 cut(s) 178
Hin1II CATG 1 cut(s) 145
HinfI GANTC 1 cut(s) 91
HphI GGTGA 1 cut(s) 211
Hpy188I TCNGA 3 cut(s) 96, 138, 150
HpyCH4V TGCA 2 cut(s) 13, 213
HpyF10VI GCNNNNNNNGC 1 cut(s) 175
HpyF3I CTNAG 2 cut(s) 114, 195
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 84, 105, 132, 295
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 1 cut(s) 16
MflI RGATCY 1 cut(s) 145
MluCI AATT 4 cut(s) 152, 163, 214, 220
MnlI CCTC 3 cut(s) 244, 250, 262
Mph1103I ATGCAT 1 cut(s) 15
MseI TTAA 1 cut(s) 307
MspR9I CCNGG 1 cut(s) 120
Mva1269I GAATGC 1 cut(s) 169
MvaI CCWGG 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 175
NdeII GATC 1 cut(s) 145
NlaIII CATG 1 cut(s) 145
NlaIV GGNNCC 2 cut(s) 147, 177
NmeAIII GCCGAG 1 cut(s) 204
NsiI ATGCAT 1 cut(s) 15
PctI GAATGC 1 cut(s) 169
PfeI GAWTC 1 cut(s) 91
PsiI TTATAA 1 cut(s) 219
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
PspN4I GGNNCC 2 cut(s) 147, 177
PspPI GGNCC 1 cut(s) 176
PsuI RGATCY 1 cut(s) 145
SaqAI TTAA 1 cut(s) 307
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 120
SetI ASST 3 cut(s) 115, 201, 255
Sse9I AATT 4 cut(s) 152, 163, 214, 220
SsiI CCGC 1 cut(s) 288
StyD4I CCNGG 1 cut(s) 118
TaqI TCGA 1 cut(s) 255
TasI AATT 4 cut(s) 152, 163, 214, 220
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 307
Tru9I TTAA 1 cut(s) 307
TscAI CASTG 1 cut(s) 61
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 61
XapI RAATTY 2 cut(s) 152, 163
Zsp2I ATGCAT 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.