Rmu_sc0001349.1_g000001
MYB Family

Alcohol dehydrogenase transcription factor Myb/SANT-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001349.1
OG0029558
Physical Location & Seq
Forward (+)
7590 .. 9138
1549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001349.1_g000001.1.cds

Sequence Viewer

Length: 411 bp
atgagaaagacgatgagcgacaaatggaggaagcagcaggatcagggattctatgaggaattgaggtatgggttgaatatgaagagtatgcataagatgtataggaatggagttggggttggggttggggggagtggtaagggcagtgttggtggtggaagtggtgggtttaggattaggattctgactgggattagtatagctcagcctgggaacaaagtttatccgaagatggattcgaaattcgggttgaattcgcattcggggccgagttatactactgctaagatggagatgaagaggaccgagatgattttgcagtcacagcagtggattgtggaggcttttgcaaaggctgtatcggagaagaagaagaagaaggctaagagaatgccgtcgtctgaggcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_4

Protein Analysis

136

Amino Acids

15.12

Weight (kDa)

10.26

Isoelectric Point (pI)

63.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029558)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0345771
rosa_multiflora Rmu_sc0001349.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 48
AcsI RAATTY 2 cut(s) 242, 253
AgsI TTSAA 2 cut(s) 76, 253
AjnI CCWGG 1 cut(s) 208
AleI CACNNNNGTG 1 cut(s) 328
AluBI AGCT 1 cut(s) 203
AluI AGCT 1 cut(s) 203
AlwI GGATC 1 cut(s) 48
AoxI GGCC 1 cut(s) 266
ApeKI GCWGC 1 cut(s) 34
ApoI RAATTY 2 cut(s) 242, 253
AspS9I GGNCC 2 cut(s) 266, 303
AsuII TTCGAA 1 cut(s) 239
AvaII GGWCC 1 cut(s) 303
BbvI GCAGC 1 cut(s) 46
BccI CCATC 2 cut(s) 226, 283
BceAI ACGGC 1 cut(s) 379
BciT130I CCWGG 1 cut(s) 210
BisI GCNGC 1 cut(s) 35
BlpI GCTNAGC 1 cut(s) 204
BlsI GCNGC 1 cut(s) 36
Bme1390I CCNGG 1 cut(s) 210
Bme18I GGWCC 1 cut(s) 303
BmgT120I GGNCC 2 cut(s) 266, 303
BmiI GGNNCC 1 cut(s) 267
BmrFI CCNGG 1 cut(s) 210
BmrI ACTGGG 1 cut(s) 198
BmuI ACTGGG 1 cut(s) 198
Bpu1102I GCTNAGC 1 cut(s) 204
Bpu14I TTCGAA 1 cut(s) 239
BsaJI CCNNGG 1 cut(s) 209
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
Bse1I ACTGG 1 cut(s) 193
BseBI CCWGG 1 cut(s) 210
BseDI CCNNGG 1 cut(s) 209
BseMII CTCAG 2 cut(s) 218, 393
BseNI ACTGG 1 cut(s) 193
BseXI GCAGC 1 cut(s) 46
BshFI GGCC 1 cut(s) 268
BsmI GAATGC 2 cut(s) 259, 396
BsnI GGCC 1 cut(s) 268
Bsp119I TTCGAA 1 cut(s) 239
Bsp143I GATC 1 cut(s) 40
Bsp1720I GCTNAGC 1 cut(s) 204
BspANI GGCC 1 cut(s) 268
BspCNI CTCAG 2 cut(s) 217, 394
BspLI GGNNCC 1 cut(s) 267
BspPI GGATC 1 cut(s) 48
BspT104I TTCGAA 1 cut(s) 239
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 209
BssMI GATC 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 210
Bst6I CTCTTC 2 cut(s) 77, 293
BstBI TTCGAA 1 cut(s) 239
BstDEI CTNAG 5 cut(s) 204, 285, 384, 402, 408
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 2 cut(s) 265, 325
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BstV1I GCAGC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 268
BtsI GCAGTG 2 cut(s) 151, 335
BtsIMutI CAGTG 2 cut(s) 151, 335
Cfr13I GGNCC 2 cut(s) 266, 303
CviJI RGCY 7 cut(s) 203, 208, 268, 344, 356, 383, 407
CviKI_1 RGCY 7 cut(s) 203, 208, 268, 344, 356, 383, 407
DdeI CTNAG 5 cut(s) 204, 285, 384, 402, 408
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eam1104I CTCTTC 2 cut(s) 77, 293
EarI CTCTTC 2 cut(s) 77, 293
Eco47I GGWCC 1 cut(s) 303
EcoRI GAATTC 1 cut(s) 253
EcoRII CCWGG 1 cut(s) 208
EcoT22I ATGCAT 1 cut(s) 93
FaiI YATR 8 cut(s) 54, 69, 80, 89, 93, 102, 200, 276
Fnu4HI GCNGC 1 cut(s) 35
Fsp4HI GCNGC 1 cut(s) 35
GluI GCNGC 1 cut(s) 35
HaeIII GGCC 1 cut(s) 268
HinfI GANTC 3 cut(s) 48, 181, 236
Hpy188I TCNGA 4 cut(s) 186, 228, 364, 403
Hpy99I CGWCG 1 cut(s) 400
HpyAV CCTTC 1 cut(s) 373
HpyCH4V TGCA 3 cut(s) 91, 319, 350
HpyF10VI GCNNNNNNNGC 2 cut(s) 265, 325
HpyF3I CTNAG 5 cut(s) 204, 285, 384, 402, 408
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 5 cut(s) 23, 29, 174, 195, 222
Lsp1109I GCAGC 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 321
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 7 cut(s) 94, 241, 310, 379, 382, 385, 388
MluCI AATT 3 cut(s) 59, 242, 253
MnlI CCTC 6 cut(s) 21, 49, 57, 294, 334, 397
Mph1103I ATGCAT 1 cut(s) 93
MslI CAYNNNNRTG 1 cut(s) 328
MspR9I CCNGG 1 cut(s) 210
Mva1269I GAATGC 2 cut(s) 259, 396
MvaI CCWGG 1 cut(s) 210
MwoI GCNNNNNNNGC 2 cut(s) 265, 325
NdeII GATC 1 cut(s) 40
NlaIV GGNNCC 1 cut(s) 267
NmeAIII GCCGAG 1 cut(s) 294
NmuCI GTSAC 1 cut(s) 321
NsiI ATGCAT 1 cut(s) 93
NspV TTCGAA 1 cut(s) 239
OliI CACNNNNGTG 1 cut(s) 328
PctI GAATGC 2 cut(s) 259, 396
PfeI GAWTC 3 cut(s) 48, 181, 236
PkrI GCNGC 1 cut(s) 36
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 267
PspPI GGNCC 2 cut(s) 266, 303
RseI CAYNNNNRTG 1 cut(s) 328
SatI GCNGC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 40
Sau96I GGNCC 2 cut(s) 266, 303
ScrFI CCNGG 1 cut(s) 210
SetI ASST 2 cut(s) 68, 205
SfuI TTCGAA 1 cut(s) 239
SgeI CNNG 9 cut(s) 50, 56, 201, 221, 222, 259, 276, 282, 319
SinI GGWCC 1 cut(s) 303
SmiMI CAYNNNNRTG 1 cut(s) 328
Sse9I AATT 3 cut(s) 59, 242, 253
StyD4I CCNGG 1 cut(s) 208
TaqI TCGA 1 cut(s) 239
TaqII GACCGA 1 cut(s) 320
TasI AATT 3 cut(s) 59, 242, 253
TfiI GAWTC 3 cut(s) 48, 181, 236
TscAI CASTG 2 cut(s) 151, 335
TseFI GTSAC 1 cut(s) 321
TseI GCWGC 1 cut(s) 34
Tsp45I GTSAC 1 cut(s) 321
TspDTI ATGAA 2 cut(s) 95, 311
TspRI CASTG 2 cut(s) 151, 335
VpaK11BI GGWCC 1 cut(s) 303
XapI RAATTY 2 cut(s) 242, 253
Zsp2I ATGCAT 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.