RchiOBHm_Chr1g0357721

Inorganic pyrophosphatase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
50043547 .. 50043705
159 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58294

Sequence Viewer

Length: 159 bp
ATGATCAACTTGGGTGATGGAGTTGGTGATTATTGCCCTAGCTTGAAGCTGAGGGAAGGAGATTTTGTGATGCCAAGGAAGAATTTCCCGCTTTTCGATAAGATTTGCCAGAACCCTCTGGCTCTTAAGGCTAAGATTCATGAGTGGACTGATGGGTAA

Protein Analysis

52

Amino Acids

5.89

Weight (kDa)

6.52

Isoelectric Point (pI)

12.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Put_Phosphatase PF06888 1 - 52 2.8e-18 Putative Phosphatase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029697)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0357721
rosa_rugosa Rorug02G0383600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AcsI RAATTY 1 cut(s) 82
AflII CTTAAG 1 cut(s) 125
AgsI TTSAA 1 cut(s) 46
AluBI AGCT 2 cut(s) 42, 49
AluI AGCT 2 cut(s) 42, 49
ApoI RAATTY 1 cut(s) 82
Asp700I GAANNNNTTC 1 cut(s) 83
AsuHPI GGTGA 2 cut(s) 26, 38
BbvCI CCTCAGC 1 cut(s) 50
BccI CCATC 2 cut(s) 11, 146
BclI TGATCA 1 cut(s) 3
BfaI CTAG 1 cut(s) 39
BfrI CTTAAG 1 cut(s) 125
BmsI GCATC 1 cut(s) 60
Bpu10I CCTNAGC 1 cut(s) 50
BsaJI CCNNGG 1 cut(s) 74
BsaXI ACNNNNNCTCC 2 cut(s) 51, 81
BseDI CCNNGG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 41
Bsp143I GATC 1 cut(s) 3
BspACI CCGC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 42
BspHI TCATGA 1 cut(s) 139
BspTI CTTAAG 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 74
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 1 cut(s) 74
BstAFI CTTAAG 1 cut(s) 125
BstDEI CTNAG 2 cut(s) 50, 132
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 1 cut(s) 128
CciI TCATGA 1 cut(s) 139
CviAII CATG 1 cut(s) 140
CviJI RGCY 4 cut(s) 42, 49, 122, 131
CviKI_1 RGCY 4 cut(s) 42, 49, 122, 131
DdeI CTNAG 2 cut(s) 50, 132
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 74
EcoT14I CCWWGG 1 cut(s) 74
ErhI CCWWGG 1 cut(s) 74
FaeI CATG 1 cut(s) 143
FaiI YATR 1 cut(s) 141
FatI CATG 1 cut(s) 139
FauI CCCGC 1 cut(s) 96
FbaI TGATCA 1 cut(s) 3
FspBI CTAG 1 cut(s) 39
Hin1II CATG 1 cut(s) 143
HinfI GANTC 1 cut(s) 136
HphI GGTGA 2 cut(s) 26, 38
Hpy166II GTNNAC 1 cut(s) 147
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 1 cut(s) 147
HpyAV CCTTC 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
HpyF3I CTNAG 2 cut(s) 50, 132
Hsp92II CATG 1 cut(s) 143
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 104, 122
LweI GCATC 1 cut(s) 60
MaeI CTAG 1 cut(s) 39
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 91
MluCI AATT 1 cut(s) 82
MnlI CCTC 2 cut(s) 45, 126
MroXI GAANNNNTTC 1 cut(s) 83
MseI TTAA 1 cut(s) 126
MspCI CTTAAG 1 cut(s) 125
MwoI GCNNNNNNNGC 1 cut(s) 128
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 143
PagI TCATGA 1 cut(s) 139
PdmI GAANNNNTTC 1 cut(s) 83
PfeI GAWTC 1 cut(s) 136
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 3
SetI ASST 2 cut(s) 44, 51
SfaNI GCATC 1 cut(s) 60
SgeI CNNG 8 cut(s) 22, 51, 55, 87, 100, 121, 131, 152
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 1 cut(s) 82
SsiI CCGC 1 cut(s) 89
SspMI CTAG 1 cut(s) 39
StyI CCWWGG 1 cut(s) 74
TaqI TCGA 1 cut(s) 96
TasI AATT 1 cut(s) 82
TfiI GAWTC 1 cut(s) 136
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 128
Vha464I CTTAAG 1 cut(s) 125
XapI RAATTY 1 cut(s) 82
XmnI GAANNNNTTC 1 cut(s) 83
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.