RchiOBHm_Chr1g0363351

mRNA-decapping enzyme subunit 2-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0024787
Physical Location & Seq
Forward (+)
54788596 .. 54788945
350 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58810

Sequence Viewer

Length: 174 bp
ATGTCTAGATTGTGGATATTTTCTTTTTCTACTTTTGCTCATGAACTTTTTCTTTCATCATTTTTAGGAATCAGTATATGGATAGCGAAAGACAGCTTGATAGGGAGTATCAACATGATAATAGAGAGCCAATTAACTAAACCTGAACCTGATGTGTCCATCCTCCTAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000003 GO:0000166 GO:0000287 GO:0000288 GO:0000290 GO:0000291 GO:0000932 GO:0000956 GO:0003006 GO:0003674 GO:0003676 GO:0003723 GO:0003727 GO:0003729 GO:0003824 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005845 GO:0006139 GO:0006401 GO:0006402 GO:0006725 GO:0006807 GO:0007275 GO:0008144 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009653 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0009892 GO:0009933 GO:0009987 GO:0010014 GO:0010016 GO:0010072 GO:0010154 GO:0010468 GO:0010494 GO:0010605 GO:0010608 GO:0010629 GO:0016032 GO:0016070 GO:0016071 GO:0016441 GO:0016458 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0017076 GO:0019048 GO:0019222 GO:0019439 GO:0022414 GO:0030145 GO:0030554 GO:0031086 GO:0031087 GO:0032501 GO:0032502 GO:0032553 GO:0032555 GO:0032559 GO:0032991 GO:0034428 GO:0034518 GO:0034641 GO:0034655 GO:0035639 GO:0035770 GO:0035821 GO:0036094 GO:0036464 GO:0040029 GO:0043167 GO:0043168 GO:0043169 GO:0043170 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044003 GO:0044237 GO:0044238 GO:0044248 GO:0044260 GO:0044265 GO:0044270 GO:0044403 GO:0044419 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0046700 GO:0046872 GO:0046914 GO:0048316 GO:0048367 GO:0048507 GO:0048508 GO:0048519 GO:0048532 GO:0048608 GO:0048731 GO:0048856 GO:0050072 GO:0050789 GO:0051701 GO:0051704 GO:0051817 GO:0060255 GO:0061458 GO:0065007 GO:0071704 GO:0090304 GO:0090305 GO:0090421 GO:0097159 GO:0097367 GO:0098745 GO:1901265 GO:1901360 GO:1901361 GO:1901363 GO:1901575 GO:1990904
KEGG Pathways
Metabolic & Signaling
ko03018 map03018
Pfam Domains
Protein Families
DCP2 NUDIX

Protein Analysis

57

Amino Acids

6.45

Weight (kDa)

4.9

Isoelectric Point (pI)

52.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024787)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0363351
rosa_samantha Rh1AG315300 Rh1CG295000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
Asp700I GAANNNNTTC 1 cut(s) 48
BccI CCATC 1 cut(s) 167
BfaI CTAG 1 cut(s) 6
BseGI GGATG 1 cut(s) 159
BspHI TCATGA 1 cut(s) 40
BstF5I GGATG 1 cut(s) 159
BtsCI GGATG 1 cut(s) 159
CciI TCATGA 1 cut(s) 40
CviAII CATG 2 cut(s) 41, 115
CviJI RGCY 2 cut(s) 96, 129
CviKI_1 RGCY 2 cut(s) 96, 129
FaeI CATG 2 cut(s) 44, 118
FaiI YATR 5 cut(s) 42, 77, 79, 116, 172
FatI CATG 2 cut(s) 40, 114
FokI GGATG 1 cut(s) 146
FspBI CTAG 1 cut(s) 6
FspEI CC 7 cut(s) 51, 64, 87, 88, 143, 156, 162
Hin1II CATG 2 cut(s) 44, 118
HinfI GANTC 1 cut(s) 69
Hpy188III TCNNGA 2 cut(s) 6, 41
Hsp92II CATG 2 cut(s) 44, 118
LpnPI CCDG 2 cut(s) 156, 162
MaeI CTAG 1 cut(s) 6
MluCI AATT 1 cut(s) 131
MnlI CCTC 1 cut(s) 173
MroXI GAANNNNTTC 1 cut(s) 48
MseI TTAA 1 cut(s) 134
NlaIII CATG 2 cut(s) 44, 118
PagI TCATGA 1 cut(s) 40
PdmI GAANNNNTTC 1 cut(s) 48
PfeI GAWTC 1 cut(s) 69
SaqAI TTAA 1 cut(s) 134
SetI ASST 3 cut(s) 98, 145, 151
SgeI CNNG 6 cut(s) 18, 53, 109, 127, 155, 161
Sse9I AATT 1 cut(s) 131
SspMI CTAG 1 cut(s) 6
TasI AATT 1 cut(s) 131
TfiI GAWTC 1 cut(s) 69
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TspDTI ATGAA 2 cut(s) 45, 57
XbaI TCTAGA 1 cut(s) 5
XmnI GAANNNNTTC 1 cut(s) 48
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.