Rh1AG315300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
54801337 .. 54808545
7209 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG315300.1

Sequence Viewer

Length: 171 bp
ATGAAGGAAACCGCATGTAATGGGCCGGATGATCTTCAGCCAGCAAGTGACGATGTAATATCTTCTGGAATCAGTATATGGATAGCGAAAGACAGCTTGATAGGGAGTATCAACATGGTTTGGTTTTATACATATTTTGTAAACAACTGTGTAGAAATCCATATGCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.25

Weight (kDa)

4.09

Isoelectric Point (pI)

39.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024787)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0363351
rosa_samantha Rh1AG315300 Rh1CG295000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 12
AcuI CTGAAG 1 cut(s) 20
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
AoxI GGCC 1 cut(s) 23
AspS9I GGNCC 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 23
BseGI GGATG 1 cut(s) 34
BshFI GGCC 1 cut(s) 25
BsiSI CCGG 1 cut(s) 26
BsnI GGCC 1 cut(s) 25
Bsp143I GATC 1 cut(s) 31
BspACI CCGC 1 cut(s) 12
BspANI GGCC 1 cut(s) 25
BssMI GATC 1 cut(s) 31
Bst4CI ACNGT 1 cut(s) 149
BstC8I GCNNGC 1 cut(s) 42
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 18
BsuRI GGCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 23
CviAII CATG 2 cut(s) 15, 115
CviJI RGCY 3 cut(s) 25, 40, 96
CviKI_1 RGCY 3 cut(s) 25, 40, 96
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Eco57I CTGAAG 1 cut(s) 20
FaeI CATG 2 cut(s) 18, 118
FaiI YATR 9 cut(s) 16, 77, 79, 116, 129, 133, 162, 164, 169
FatI CATG 2 cut(s) 14, 114
FauNDI CATATG 1 cut(s) 162
FokI GGATG 1 cut(s) 41
HaeIII GGCC 1 cut(s) 25
HapII CCGG 1 cut(s) 26
Hin1II CATG 2 cut(s) 18, 118
HinfI GANTC 1 cut(s) 69
HpaII CCGG 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 142
Hpy188III TCNNGA 1 cut(s) 66
Hpy8I GTNNAC 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 149
Hsp92II CATG 2 cut(s) 18, 118
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 3 cut(s) 39, 51, 54
MaeIII GTNAC 1 cut(s) 47
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 2 cut(s) 26, 54
MspI CCGG 1 cut(s) 26
NdeI CATATG 1 cut(s) 162
NdeII GATC 1 cut(s) 31
NlaIII CATG 2 cut(s) 18, 118
NmuCI GTSAC 1 cut(s) 47
NspI RCATGY 1 cut(s) 18
PfeI GAWTC 1 cut(s) 69
PspPI GGNCC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 1 cut(s) 23
SetI ASST 1 cut(s) 98
SgeI CNNG 7 cut(s) 27, 38, 53, 57, 78, 109, 127
SsiI CCGC 1 cut(s) 12
TaaI ACNGT 1 cut(s) 149
TfiI GAWTC 1 cut(s) 69
TseFI GTSAC 1 cut(s) 47
Tsp45I GTSAC 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.