Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0021300

Physical Location & Seq

Genomic Coordinates Reverse (-)

62976329 .. 62976544

Gene Structure 216 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ59930

Sequence Viewer

CDS Protein Promoter (2k)

Length: 216 bp

ATGGCCATTTCCCCTTCTCCTCAAGAAGCTATGTCAATCTTTGTTGAGCGAATTTTGGAGTGGAGAGATACATGTCTACTAAACAAATTGTTAGTGAAACCATCCCTGGTGAATCAACCTCTGTTGGAAGAAGAAGGGGCATTGCTATTATATCTCAGAATGCTGGCGTGGCATATGAGAGGACAAGAGAACTTGCTAGAGATCTGGGAGCCATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000145 GO:0005575 GO:0005576 GO:0005615 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005938 GO:0006810 GO:0006887 GO:0006892 GO:0006893 GO:0008150 GO:0009987 GO:0016192 GO:0031982 GO:0032940 GO:0032991 GO:0043226 GO:0043227 GO:0043230 GO:0044421 GO:0044424 GO:0044444 GO:0044448 GO:0044464 GO:0046903 GO:0048193 GO:0051179 GO:0051234 GO:0070062 GO:0071944 GO:0098876 GO:0099023 GO:0099568 GO:1903561

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Sec10

Protein Analysis

71

Amino Acids

8.32

Weight (kDa)

4.78

Isoelectric Point (pI)

64.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021300)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0375601
rosa_samantha	Rh1AG402500 Rh1BG366700 Rh1CG379400 Rh1DG397000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	76
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	1 cut(s)	51
AflIII	ACRYGT	1 cut(s)	71
AjnI	CCWGG	1 cut(s)	105
AluBI	AGCT	1 cut(s)	29
AluI	AGCT	1 cut(s)	29
AoxI	GGCC	1 cut(s)	3
ApoI	RAATTY	1 cut(s)	51
AsuHPI	GGTGA	1 cut(s)	121
BalI	TGGCCA	1 cut(s)	5
BccI	CCATC	1 cut(s)	109
BciT130I	CCWGG	1 cut(s)	107
BfaI	CTAG	1 cut(s)	197
BglII	AGATCT	1 cut(s)	201
Bme1390I	CCNGG	1 cut(s)	107
BmiI	GGNNCC	1 cut(s)	210
BmrFI	CCNGG	1 cut(s)	107
BpuEI	CTTGAG	1 cut(s)	6
BsaJI	CCNNGG	1 cut(s)	105
Bse3DI	GCAATG	1 cut(s)	140
BseBI	CCWGG	1 cut(s)	107
BseDI	CCNNGG	1 cut(s)	105
BseGI	GGATG	1 cut(s)	101
BseMI	GCAATG	1 cut(s)	140
BseMII	CTCAG	1 cut(s)	169
BseRI	GAGGAG	1 cut(s)	9
BshFI	GGCC	1 cut(s)	5
BsmI	GAATGC	1 cut(s)	165
BsnI	GGCC	1 cut(s)	5
Bsp143I	GATC	1 cut(s)	201
BspANI	GGCC	1 cut(s)	5
BspCNI	CTCAG	1 cut(s)	168
BspLI	GGNNCC	1 cut(s)	210
BsrDI	GCAATG	1 cut(s)	140
BssECI	CCNNGG	1 cut(s)	105
BssMI	GATC	1 cut(s)	201
Bst2UI	CCWGG	1 cut(s)	107
BstC8I	GCNNGC	1 cut(s)	165
BstDEI	CTNAG	1 cut(s)	155
BstF5I	GGATG	1 cut(s)	101
BstKTI	GATC	1 cut(s)	204
BstMBI	GATC	1 cut(s)	201
BstMWI	GCNNNNNNNGC	1 cut(s)	169
BstNI	CCWGG	1 cut(s)	107
BstNSI	RCATGY	1 cut(s)	75
BstSCI	CCNGG	1 cut(s)	105
BstX2I	RGATCY	1 cut(s)	201
BstYI	RGATCY	1 cut(s)	201
BsuRI	GGCC	1 cut(s)	5
BtsCI	GGATG	1 cut(s)	101
Cac8I	GCNNGC	1 cut(s)	165
CviAII	CATG	1 cut(s)	72
CviJI	RGCY	3 cut(s)	5, 29, 211
CviKI_1	RGCY	3 cut(s)	5, 29, 211
DdeI	CTNAG	1 cut(s)	155
DpnI	GATC	1 cut(s)	203
DpnII	GATC	1 cut(s)	201
EaeI	YGGCCR	1 cut(s)	3
EcoRII	CCWGG	1 cut(s)	105
FaeI	CATG	1 cut(s)	75
FaiI	YATR	6 cut(s)	32, 73, 151, 174, 176, 214
FatI	CATG	1 cut(s)	71
FauNDI	CATATG	1 cut(s)	174
FblI	GTMKAC	1 cut(s)	76
FokI	GGATG	1 cut(s)	88
FspBI	CTAG	1 cut(s)	197
HaeIII	GGCC	1 cut(s)	5
Hin1II	CATG	1 cut(s)	75
HinfI	GANTC	1 cut(s)	112
HphI	GGTGA	1 cut(s)	121
Hpy166II	GTNNAC	1 cut(s)	77
Hpy188I	TCNGA	1 cut(s)	158
Hpy188III	TCNNGA	1 cut(s)	23
Hpy8I	GTNNAC	1 cut(s)	77
HpyAV	CCTTC	2 cut(s)	24, 128
HpyF10VI	GCNNNNNNNGC	1 cut(s)	169
HpyF3I	CTNAG	1 cut(s)	155
Hsp92II	CATG	1 cut(s)	75
Kzo9I	GATC	1 cut(s)	201
LmnI	GCTCC	1 cut(s)	208
LpnPI	CCDG	4 cut(s)	92, 119, 149, 190
MaeI	CTAG	1 cut(s)	197
MalI	GATC	1 cut(s)	203
MboI	GATC	1 cut(s)	201
MboII	GAAGA	2 cut(s)	140, 143
MflI	RGATCY	1 cut(s)	201
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	2 cut(s)	51, 86
MluNI	TGGCCA	1 cut(s)	5
MmeI	TCCRAC	1 cut(s)	105
MnlI	CCTC	3 cut(s)	30, 129, 173
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
Msp20I	TGGCCA	1 cut(s)	5
MspR9I	CCNGG	1 cut(s)	107
Mva1269I	GAATGC	1 cut(s)	165
MvaI	CCWGG	1 cut(s)	107
MwoI	GCNNNNNNNGC	1 cut(s)	169
NdeI	CATATG	1 cut(s)	174
NdeII	GATC	1 cut(s)	201
NlaIII	CATG	1 cut(s)	75
NlaIV	GGNNCC	1 cut(s)	210
NspI	RCATGY	1 cut(s)	75
PciI	ACATGT	1 cut(s)	71
PctI	GAATGC	1 cut(s)	165
PfeI	GAWTC	1 cut(s)	112
PscI	ACATGT	1 cut(s)	71
Psp6I	CCWGG	1 cut(s)	105
PspGI	CCWGG	1 cut(s)	105
PspN4I	GGNNCC	1 cut(s)	210
PsuI	RGATCY	1 cut(s)	201
Sau3AI	GATC	1 cut(s)	201
ScrFI	CCNGG	1 cut(s)	107
SetI	ASST	2 cut(s)	31, 121
SgeI	CNNG	9 cut(s)	35, 84, 118, 119, 176, 180, 197, 205, 209
SmlI	CTYRAG	1 cut(s)	21
SmoI	CTYRAG	1 cut(s)	21
Sse9I	AATT	2 cut(s)	51, 86
SspMI	CTAG	1 cut(s)	197
StyD4I	CCNGG	1 cut(s)	105
TasI	AATT	2 cut(s)	51, 86
TfiI	GAWTC	1 cut(s)	112
XapI	RAATTY	1 cut(s)	51
XceI	RCATGY	1 cut(s)	75
XmiI	GTMKAC	1 cut(s)	76
XspI	CTAG	1 cut(s)	197

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.