Rh1AG402500

exocyst complex component

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0021300
Physical Location & Seq
Reverse (-)
62938363 .. 62938722
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG402500.1

Sequence Viewer

Length: 360 bp
ATGGAAGTCATGAATGCTGATGTCAAATTGGTTCTTGGTGATGATCAGGGTTCCAGGAAGACTAGTGTTTGCAATGTTTCTCGTGGACTTTCTTCCTTATATAAAGGAATGACAGATATTGTAGGTAAGGAAGCACCAACAATAATGGCCATTTTCCCTTCTCCTCAAGAAGCTATGTCAATCTTTGTTGAGCGAATTTTGGAGTGGAGAGATACAGGTCTACTAAACAAATCGTTAGTGAAACCATCCCTGGTGAATCAACCTCTGTTGGAAGAAGAAGGGGCATTGCTATTATATCTCAGAATGCTGGCGTGGCATATGAGAGGACAAGAGAACTTGCTAGAGATCTGGGAGCCATAG

Protein Analysis

119

Amino Acids

13.4

Weight (kDa)

4.97

Isoelectric Point (pI)

39.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sec10_HB PF07393 7 - 104 2.3e-08 Exocyst complex component Sec10-like, alpha-helical bundle
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021300)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0375601
rosa_samantha Rh1AG402500 Rh1BG366700 Rh1CG379400 Rh1DG397000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 220
AcoI YGGCCR 1 cut(s) 147
AcsI RAATTY 1 cut(s) 195
AhlI ACTAGT 1 cut(s) 62
AjnI CCWGG 2 cut(s) 53, 249
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AoxI GGCC 1 cut(s) 147
ApoI RAATTY 1 cut(s) 195
AsuHPI GGTGA 2 cut(s) 50, 265
BalI TGGCCA 1 cut(s) 149
BauI CACGAG 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 65
BccI CCATC 1 cut(s) 253
BciT130I CCWGG 2 cut(s) 55, 251
BclI TGATCA 1 cut(s) 43
BcuI ACTAGT 1 cut(s) 62
BfaI CTAG 2 cut(s) 63, 341
BglII AGATCT 1 cut(s) 345
Bme1390I CCNGG 2 cut(s) 55, 251
BmiI GGNNCC 2 cut(s) 52, 354
BmrFI CCNGG 2 cut(s) 55, 251
BpiI GAAGAC 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 249
Bse3DI GCAATG 2 cut(s) 79, 284
BseBI CCWGG 2 cut(s) 55, 251
BseDI CCNNGG 1 cut(s) 249
BseGI GGATG 1 cut(s) 245
BseMI GCAATG 2 cut(s) 79, 284
BseMII CTCAG 1 cut(s) 313
BseRI GAGGAG 1 cut(s) 153
BshFI GGCC 1 cut(s) 149
BsmI GAATGC 2 cut(s) 19, 309
BsnI GGCC 1 cut(s) 149
Bsp143I GATC 2 cut(s) 43, 345
BspANI GGCC 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 312
BspHI TCATGA 1 cut(s) 9
BspLI GGNNCC 2 cut(s) 52, 354
BsrDI GCAATG 2 cut(s) 79, 284
BssECI CCNNGG 1 cut(s) 249
BssMI GATC 2 cut(s) 43, 345
BssSI CACGAG 1 cut(s) 81
Bst2BI CACGAG 1 cut(s) 81
Bst2UI CCWGG 2 cut(s) 55, 251
BstC8I GCNNGC 1 cut(s) 309
BstDEI CTNAG 1 cut(s) 299
BstF5I GGATG 1 cut(s) 245
BstKTI GATC 2 cut(s) 46, 348
BstMBI GATC 2 cut(s) 43, 345
BstMWI GCNNNNNNNGC 1 cut(s) 313
BstNI CCWGG 2 cut(s) 55, 251
BstSCI CCNGG 2 cut(s) 53, 249
BstV2I GAAGAC 1 cut(s) 65
BstX2I RGATCY 1 cut(s) 345
BstYI RGATCY 1 cut(s) 345
BsuRI GGCC 1 cut(s) 149
BtsCI GGATG 1 cut(s) 245
Cac8I GCNNGC 1 cut(s) 309
CciI TCATGA 1 cut(s) 9
CviAII CATG 1 cut(s) 10
CviJI RGCY 3 cut(s) 149, 173, 355
CviKI_1 RGCY 3 cut(s) 149, 173, 355
DdeI CTNAG 1 cut(s) 299
DpnI GATC 2 cut(s) 45, 347
DpnII GATC 2 cut(s) 43, 345
EaeI YGGCCR 1 cut(s) 147
EcoRII CCWGG 2 cut(s) 53, 249
FaeI CATG 1 cut(s) 13
FaiI YATR 8 cut(s) 11, 100, 102, 176, 295, 318, 320, 358
FatI CATG 1 cut(s) 9
FauNDI CATATG 1 cut(s) 318
FbaI TGATCA 1 cut(s) 43
FblI GTMKAC 1 cut(s) 220
FokI GGATG 1 cut(s) 232
FspBI CTAG 2 cut(s) 63, 341
HaeIII GGCC 1 cut(s) 149
Hin1II CATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 256
HphI GGTGA 2 cut(s) 50, 265
Hpy166II GTNNAC 2 cut(s) 86, 221
Hpy188I TCNGA 1 cut(s) 302
Hpy188III TCNNGA 2 cut(s) 10, 167
Hpy8I GTNNAC 2 cut(s) 86, 221
HpyAV CCTTC 2 cut(s) 168, 272
HpyCH4V TGCA 1 cut(s) 72
HpyF10VI GCNNNNNNNGC 1 cut(s) 313
HpyF3I CTNAG 1 cut(s) 299
Hsp92II CATG 1 cut(s) 13
Ksp22I TGATCA 1 cut(s) 43
Kzo9I GATC 2 cut(s) 43, 345
LmnI GCTCC 1 cut(s) 352
LpnPI CCDG 8 cut(s) 32, 40, 67, 201, 236, 263, 293, 334
MaeI CTAG 2 cut(s) 63, 341
MalI GATC 2 cut(s) 45, 347
MboI GATC 2 cut(s) 43, 345
MboII GAAGA 4 cut(s) 70, 84, 284, 287
MflI RGATCY 1 cut(s) 345
MlsI TGGCCA 1 cut(s) 149
MluCI AATT 2 cut(s) 26, 195
MluNI TGGCCA 1 cut(s) 149
MmeI TCCRAC 1 cut(s) 249
MnlI CCTC 3 cut(s) 174, 273, 317
Mox20I TGGCCA 1 cut(s) 149
MscI TGGCCA 1 cut(s) 149
Msp20I TGGCCA 1 cut(s) 149
MspR9I CCNGG 2 cut(s) 55, 251
Mva1269I GAATGC 2 cut(s) 19, 309
MvaI CCWGG 2 cut(s) 55, 251
MwoI GCNNNNNNNGC 1 cut(s) 313
NdeI CATATG 1 cut(s) 318
NdeII GATC 2 cut(s) 43, 345
NlaIII CATG 1 cut(s) 13
NlaIV GGNNCC 2 cut(s) 52, 354
PagI TCATGA 1 cut(s) 9
PctI GAATGC 2 cut(s) 19, 309
PfeI GAWTC 1 cut(s) 256
PfoI TCCNGGA 1 cut(s) 53
Psp6I CCWGG 2 cut(s) 53, 249
PspGI CCWGG 2 cut(s) 53, 249
PspN4I GGNNCC 2 cut(s) 52, 354
PsuI RGATCY 1 cut(s) 345
Sau3AI GATC 2 cut(s) 43, 345
ScrFI CCNGG 2 cut(s) 55, 251
SetI ASST 4 cut(s) 127, 175, 220, 265
SmlI CTYRAG 1 cut(s) 165
SmoI CTYRAG 1 cut(s) 165
SpeI ACTAGT 1 cut(s) 62
Sse9I AATT 2 cut(s) 26, 195
SspMI CTAG 2 cut(s) 63, 341
StyD4I CCNGG 2 cut(s) 53, 249
TasI AATT 2 cut(s) 26, 195
TfiI GAWTC 1 cut(s) 256
TspDTI ATGAA 1 cut(s) 26
XapI RAATTY 1 cut(s) 195
XmiI GTMKAC 1 cut(s) 220
XspI CTAG 2 cut(s) 63, 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.