RchiOBHm_Chr2g0097651

Removes the N-terminal methionine from nascent proteins. The N-terminal methionine is often cleaved when the second residue in the primary sequence is small and uncharged (Met-Ala-, Cys, Gly, Pro, Ser, Thr, or Val)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
10249997 .. 10250227
231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47251

Sequence Viewer

Length: 180 bp
ATGTTTGGTATTGTTTTTAGCTTCCTTGTCAAGGGATATCATGGAGACACATCAAAGACATTTCTTTGTGGGAAGGTCAGTGATAGTGTGCAACGGCTAGTGAAGGTAAGCTTTTTTCAGCTTGGTATAATTGAACCTTGTGGTTATTATCAGAATTCCTCTGAACATGTGGAAAATTGA

Protein Analysis

59

Amino Acids

6.64

Weight (kDa)

6.7

Isoelectric Point (pI)

15.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029894)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0097651
rosa_samantha Rh6AG080100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 154
AfiI CCNNNNNNNGG 1 cut(s) 31
AflIII ACRYGT 1 cut(s) 166
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 3 cut(s) 21, 111, 121
AluI AGCT 3 cut(s) 21, 111, 121
Alw26I GTCTC 1 cut(s) 39
ApoI RAATTY 1 cut(s) 154
BceAI ACGGC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 39
BfaI CTAG 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 31
BsmAI GTCTC 1 cut(s) 39
BstENI CCTNNNNNAGG 1 cut(s) 29
BstMAI GTCTC 1 cut(s) 39
BstNSI RCATGY 1 cut(s) 170
BtsIMutI CAGTG 1 cut(s) 85
CviAII CATG 2 cut(s) 41, 167
CviJI RGCY 4 cut(s) 21, 97, 111, 121
CviKI_1 RGCY 4 cut(s) 21, 97, 111, 121
Eco32I GATATC 1 cut(s) 38
EcoNI CCTNNNNNAGG 1 cut(s) 29
EcoRI GAATTC 1 cut(s) 154
EcoRV GATATC 1 cut(s) 38
FaeI CATG 2 cut(s) 44, 170
FaiI YATR 3 cut(s) 42, 128, 168
FalI AAGNNNNNCTT 2 cut(s) 95, 127
FatI CATG 2 cut(s) 40, 166
FspBI CTAG 1 cut(s) 98
Hin1II CATG 2 cut(s) 44, 170
HindIII AAGCTT 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 153, 163
HpyAV CCTTC 2 cut(s) 67, 97
HpyCH4V TGCA 1 cut(s) 91
Hsp92II CATG 2 cut(s) 44, 170
MaeI CTAG 1 cut(s) 98
MluCI AATT 3 cut(s) 129, 154, 175
MnlI CCTC 1 cut(s) 169
NlaIII CATG 2 cut(s) 44, 170
NspI RCATGY 1 cut(s) 170
PciI ACATGT 1 cut(s) 166
PscI ACATGT 1 cut(s) 166
SetI ASST 6 cut(s) 23, 78, 108, 113, 123, 139
SgeI CNNG 6 cut(s) 38, 43, 53, 110, 134, 150
Sse9I AATT 3 cut(s) 129, 154, 175
SspMI CTAG 1 cut(s) 98
TasI AATT 3 cut(s) 129, 154, 175
TscAI CASTG 1 cut(s) 85
TspRI CASTG 1 cut(s) 85
XagI CCTNNNNNAGG 1 cut(s) 29
XapI RAATTY 1 cut(s) 154
XceI RCATGY 1 cut(s) 170
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.