RchiOBHm_Chr2g0110961

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0029849
Physical Location & Seq
Forward (+)
22628911 .. 22629313
403 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48457

Sequence Viewer

Length: 282 bp
ATGAGTGCAAGTCGTTTTACTTTGTTGGACAAGAGACCACAAAATACTTTGCTTTCCTGGACTATCTTTCTTCTGGCACTCCATACCGATTGGCAAGAGCAAGCGAGAAAGGAAGTCTTGCAATTATTCGGGAAAGAAACTCCAAATCCCGATGGCCTTTCCAAACTAAAAACAATGAGTATGATCATCAATGAGTCCTTGAGGCTATATTCTCCTGTTATTTACGTTCCAAGGAGAGTTGAAAAGAAAGTTAAACTTGGAAAGCTCATTGTTTCCTGCTGA

Protein Analysis

93

Amino Acids

10.76

Weight (kDa)

9.93

Isoelectric Point (pI)

45.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 18 - 88 1.1e-12 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029849)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0110961 RchiOBHm_Chr4g0437471

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 242
AjnI CCWGG 1 cut(s) 56
AluBI AGCT 1 cut(s) 265
AluI AGCT 1 cut(s) 265
Alw26I GTCTC 1 cut(s) 28
AoxI GGCC 1 cut(s) 154
BccI CCATC 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 58
BclI TGATCA 1 cut(s) 183
BcoDI GTCTC 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 58
BmrFI CCNGG 1 cut(s) 58
BpuEI CTTGAG 1 cut(s) 220
BsaI GGTCTC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 230
BseBI CCWGG 1 cut(s) 58
BseDI CCNNGG 1 cut(s) 230
BshFI GGCC 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 28
BsnI GGCC 1 cut(s) 156
Bso31I GGTCTC 1 cut(s) 28
Bsp143I GATC 1 cut(s) 183
BspANI GGCC 1 cut(s) 156
BspTNI GGTCTC 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 230
BssMI GATC 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 230
Bst2UI CCWGG 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 102
BstKTI GATC 1 cut(s) 186
BstMAI GTCTC 1 cut(s) 28
BstMBI GATC 1 cut(s) 183
BstNI CCWGG 1 cut(s) 58
BstSCI CCNGG 1 cut(s) 56
BsuRI GGCC 1 cut(s) 156
Cac8I GCNNGC 1 cut(s) 102
CviJI RGCY 3 cut(s) 156, 205, 265
CviKI_1 RGCY 3 cut(s) 156, 205, 265
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 230
Eco31I GGTCTC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 230
ErhI CCWWGG 1 cut(s) 230
FaiI YATR 3 cut(s) 84, 182, 208
FalI AAGNNNNNCTT 4 cut(s) 101, 133, 240, 272
FbaI TGATCA 1 cut(s) 183
HaeIII GGCC 1 cut(s) 156
HinfI GANTC 1 cut(s) 194
Hpy188III TCNNGA 2 cut(s) 130, 149
HpyCH4IV ACGT 1 cut(s) 225
HpyCH4V TGCA 2 cut(s) 8, 121
HpySE526I ACGT 1 cut(s) 225
Ksp22I TGATCA 1 cut(s) 183
Kzo9I GATC 1 cut(s) 183
LpnPI CCDG 4 cut(s) 43, 59, 70, 228
MaeII ACGT 1 cut(s) 225
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 1 cut(s) 62
MluCI AATT 1 cut(s) 122
MlyI GAGTC 1 cut(s) 203
MmeI TCCRAC 1 cut(s) 6
MnlI CCTC 1 cut(s) 195
MseI TTAA 1 cut(s) 252
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
NdeII GATC 1 cut(s) 183
PfoI TCCNGGA 1 cut(s) 56
PleI GAGTC 1 cut(s) 202
PpsI GAGTC 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
SaqAI TTAA 1 cut(s) 252
Sau3AI GATC 1 cut(s) 183
SchI GAGTC 1 cut(s) 203
ScrFI CCNGG 1 cut(s) 58
SetI ASST 2 cut(s) 228, 267
SmlI CTYRAG 1 cut(s) 199
SmoI CTYRAG 1 cut(s) 199
Sse9I AATT 1 cut(s) 122
StyD4I CCNGG 1 cut(s) 56
StyI CCWWGG 1 cut(s) 230
TaiI ACGT 1 cut(s) 228
TasI AATT 1 cut(s) 122
Tru1I TTAA 1 cut(s) 252
Tru9I TTAA 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.