RchiOBHm_Chr2g0113401

Cyclin-dependent kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
25565743 .. 25566567
825 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48675

Sequence Viewer

Length: 138 bp
ATGGTTCGCCAATTTTGCAAGCCTGACCAACTGAACAAGATATTTGAGCTTTGTGGATCGCCTGATGAGAACAACTGGCCTGGTGTTTCAAAATATTATTTTTATAACAATTTCAAGTCACCAAGGCCCCTGAAGTGA

Protein Analysis

45

Amino Acids

5.4

Weight (kDa)

9.1

Isoelectric Point (pI)

31.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029795)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0113401
rosa_rugosa Rorug02G0187200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 105
AclWI GGATC 1 cut(s) 64
AgsI TTSAA 2 cut(s) 90, 115
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 1 cut(s) 64
AoxI GGCC 2 cut(s) 77, 125
AspS9I GGNCC 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 126
BmiI GGNNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 122
Bse1I ACTGG 1 cut(s) 80
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 122
BseNI ACTGG 1 cut(s) 80
BshFI GGCC 2 cut(s) 79, 127
BsnI GGCC 2 cut(s) 79, 127
Bsp143I GATC 1 cut(s) 56
BspANI GGCC 2 cut(s) 79, 127
BspLI GGNNCC 1 cut(s) 128
BspPI GGATC 1 cut(s) 64
BsrI ACTGG 1 cut(s) 80
BssECI CCNNGG 1 cut(s) 122
BssMI GATC 1 cut(s) 56
BssT1I CCWWGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 20
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 15
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BsuRI GGCC 2 cut(s) 79, 127
Cac8I GCNNGC 1 cut(s) 20
Cfr13I GGNCC 1 cut(s) 126
CviJI RGCY 4 cut(s) 22, 49, 79, 127
CviKI_1 RGCY 4 cut(s) 22, 49, 79, 127
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
Eco130I CCWWGG 1 cut(s) 122
EcoO109I RGGNCCY 1 cut(s) 126
EcoRII CCWGG 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 122
FaiI YATR 1 cut(s) 105
FspEI CC 9 cut(s) 23, 36, 39, 41, 61, 66, 75, 93, 109
HaeIII GGCC 2 cut(s) 79, 127
HphI GGTGA 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 18
HpyF10VI GCNNNNNNNGC 1 cut(s) 15
Kzo9I GATC 1 cut(s) 56
LpnPI CCDG 5 cut(s) 36, 61, 66, 75, 93
MaeIII GTNAC 1 cut(s) 117
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MluCI AATT 2 cut(s) 11, 109
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 15
NdeII GATC 1 cut(s) 56
NlaIV GGNNCC 1 cut(s) 128
NmuCI GTSAC 1 cut(s) 117
PsiI TTATAA 1 cut(s) 105
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 126
Sau3AI GATC 1 cut(s) 56
Sau96I GGNCC 1 cut(s) 126
ScrFI CCNGG 1 cut(s) 81
SetI ASST 1 cut(s) 51
SgeI CNNG 8 cut(s) 31, 35, 49, 74, 88, 92, 93, 127
Sse9I AATT 2 cut(s) 11, 109
SspI AATATT 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 79
StyI CCWWGG 1 cut(s) 122
TasI AATT 2 cut(s) 11, 109
TseFI GTSAC 1 cut(s) 117
Tsp45I GTSAC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.