RchiOBHm_Chr2g0117731

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0029798
Physical Location & Seq
Reverse (-)
29980225 .. 29980638
414 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49061

Sequence Viewer

Length: 339 bp
ATGCTCTATTTGAATACAGAGAAACACCATTGGTTGCATGTCAGAGATGATGACATGTGGAGTATAGGGAATGACGATATTTTACCTGCACTCAAATTGAGCTATGATGCATTGCCACAACACTTGAAATCATGTTTTGCAATTTGTTCACTTTTCCCAAAGGATTATGCATTCAAGAGTGCAATATTGGTTCCATTGTGGATAGCACAAGGCTACCTCAAGACATCTAAGAAAAATGAAGATTTTGAACAGATGGGTATAGACTATATAAGACAGTTTTGCTCTAGATCTTTGTTTCAATTAGAGACAGATCGATGTCAAAACAGCCATAGTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

112

Amino Acids

13.19

Weight (kDa)

6.16

Isoelectric Point (pI)

36.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 51 - 108 1.8e-15 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029798)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0117731
rosa_multiflora Rmu_co8126542.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 94
AflIII ACRYGT 1 cut(s) 54
AgsI TTSAA 5 cut(s) 13, 127, 175, 248, 299
AluBI AGCT 1 cut(s) 102
AluI AGCT 1 cut(s) 102
Alw26I GTCTC 1 cut(s) 299
BccI CCATC 1 cut(s) 247
BcoDI GTCTC 1 cut(s) 299
BfaI CTAG 1 cut(s) 285
BfuAI ACCTGC 1 cut(s) 94
BglII AGATCT 1 cut(s) 287
BmiI GGNNCC 1 cut(s) 192
BmsI GCATC 1 cut(s) 97
BpuEI CTTGAG 1 cut(s) 203
Bsa29I ATCGAT 1 cut(s) 313
Bse3DI GCAATG 1 cut(s) 110
BseCI ATCGAT 1 cut(s) 313
BseMI GCAATG 1 cut(s) 110
BsgI GTGCAG 1 cut(s) 72
BshVI ATCGAT 1 cut(s) 313
BsmAI GTCTC 1 cut(s) 299
BsmI GAATGC 1 cut(s) 170
Bsp143I GATC 2 cut(s) 287, 310
BspDI ATCGAT 1 cut(s) 313
BspLI GGNNCC 1 cut(s) 192
BspMI ACCTGC 1 cut(s) 94
BsrDI GCAATG 1 cut(s) 110
BssMI GATC 2 cut(s) 287, 310
Bst4CI ACNGT 1 cut(s) 276
BstDEI CTNAG 1 cut(s) 228
BstKTI GATC 2 cut(s) 290, 313
BstMAI GTCTC 1 cut(s) 299
BstMBI GATC 2 cut(s) 287, 310
BstNSI RCATGY 2 cut(s) 41, 58
BstX2I RGATCY 1 cut(s) 287
BstYI RGATCY 1 cut(s) 287
Bsu15I ATCGAT 1 cut(s) 313
BsuTUI ATCGAT 1 cut(s) 313
BveI ACCTGC 1 cut(s) 94
ClaI ATCGAT 1 cut(s) 313
CspCI CAANNNNNGTGG 2 cut(s) 105, 140
CviAII CATG 3 cut(s) 38, 55, 132
CviJI RGCY 3 cut(s) 102, 213, 327
CviKI_1 RGCY 3 cut(s) 102, 213, 327
DdeI CTNAG 1 cut(s) 228
DpnI GATC 2 cut(s) 289, 312
DpnII GATC 2 cut(s) 287, 310
EcoT22I ATGCAT 2 cut(s) 112, 172
FaeI CATG 3 cut(s) 41, 58, 135
FatI CATG 3 cut(s) 37, 54, 131
FspBI CTAG 1 cut(s) 285
Hin1II CATG 3 cut(s) 41, 58, 135
Hpy166II GTNNAC 1 cut(s) 149
Hpy188I TCNGA 1 cut(s) 44
Hpy188III TCNNGA 3 cut(s) 175, 220, 285
Hpy8I GTNNAC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 276
HpyCH4V TGCA 6 cut(s) 37, 89, 110, 140, 170, 182
HpyF3I CTNAG 1 cut(s) 228
Hsp92II CATG 3 cut(s) 41, 58, 135
Kzo9I GATC 2 cut(s) 287, 310
LpnPI CCDG 1 cut(s) 99
LweI GCATC 1 cut(s) 97
MaeI CTAG 1 cut(s) 285
MalI GATC 2 cut(s) 289, 312
MboI GATC 2 cut(s) 287, 310
MboII GAAGA 1 cut(s) 251
MflI RGATCY 1 cut(s) 287
MluCI AATT 3 cut(s) 95, 141, 299
MnlI CCTC 1 cut(s) 227
Mph1103I ATGCAT 2 cut(s) 112, 172
MseI TTAA 1 cut(s) 337
Mva1269I GAATGC 1 cut(s) 170
NdeII GATC 2 cut(s) 287, 310
NlaIII CATG 3 cut(s) 41, 58, 135
NlaIV GGNNCC 1 cut(s) 192
NsiI ATGCAT 2 cut(s) 112, 172
NspI RCATGY 2 cut(s) 41, 58
PciI ACATGT 1 cut(s) 54
PctI GAATGC 1 cut(s) 170
PscI ACATGT 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 192
PsuI RGATCY 1 cut(s) 287
SaqAI TTAA 1 cut(s) 337
Sau3AI GATC 2 cut(s) 287, 310
SetI ASST 3 cut(s) 88, 104, 219
SfaNI GCATC 1 cut(s) 97
SgeI CNNG 9 cut(s) 50, 67, 98, 136, 144, 187, 221, 232, 297
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
Sse9I AATT 3 cut(s) 95, 141, 299
SspI AATATT 1 cut(s) 186
SspMI CTAG 1 cut(s) 285
TaaI ACNGT 1 cut(s) 276
TaqI TCGA 1 cut(s) 313
TasI AATT 3 cut(s) 95, 141, 299
Tru1I TTAA 1 cut(s) 337
Tru9I TTAA 1 cut(s) 337
TspDTI ATGAA 1 cut(s) 252
XbaI TCTAGA 1 cut(s) 284
XceI RCATGY 2 cut(s) 41, 58
XspI CTAG 1 cut(s) 285
Zsp2I ATGCAT 2 cut(s) 112, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.