Rmu_co8126542.1_g000001

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8126542.1
Physical Location & Seq
Reverse (-)
1 .. 502
502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8126542.1_g000001.1.cds

Sequence Viewer

Length: 421 bp
atgcatactttagaaggtcttccccacaaagactgcatgtcattgtttatcaaaagggcatttaagaaaggagaggagcaacgctatcaacatttgatagaaattggagaggatattgtgaataagtgtggaggagttcctttagcagttgcgactgttgggagcatgctttatttgaatacagatgaacaccaatggtctagtgtaagagatgatgacatgtggagtatagggaatgacaatattctacctgcactcagactgagctatgatgcattgccacaacacttgaaaccgtgttttgcattttgttcacttttcccaaaggattatgaattcaggagtgcaatgttggttccattgtggatagcacaaggctacctcaaggcatctaagaaaaatgaagatttggaacagatgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

140

Amino Acids

16.05

Weight (kDa)

5.68

Isoelectric Point (pI)

52.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029798)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0117731
rosa_multiflora Rmu_co8126542.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 259
AcsI RAATTY 1 cut(s) 335
AflIII ACRYGT 1 cut(s) 219
AgsI TTSAA 2 cut(s) 178, 292
AhdI GACNNNNNGTC 1 cut(s) 37
AluBI AGCT 1 cut(s) 267
AluI AGCT 1 cut(s) 267
ApoI RAATTY 1 cut(s) 335
Asp700I GAANNNNTTC 1 cut(s) 18
BbsI GAAGAC 1 cut(s) 11
BccI CCATC 1 cut(s) 412
BfaI CTAG 1 cut(s) 201
BfuAI ACCTGC 1 cut(s) 259
BmeRI GACNNNNNGTC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 357
BmsI GCATC 2 cut(s) 262, 398
BpiI GAAGAC 1 cut(s) 11
BpuEI CTTGAG 1 cut(s) 368
Bse3DI GCAATG 2 cut(s) 275, 354
BseMI GCAATG 2 cut(s) 275, 354
BseMII CTCAG 2 cut(s) 254, 271
BseRI GAGGAG 2 cut(s) 89, 147
BsgI GTGCAG 1 cut(s) 237
BspCNI CTCAG 2 cut(s) 255, 270
BspLI GGNNCC 1 cut(s) 357
BspMI ACCTGC 1 cut(s) 259
BsrDI GCAATG 2 cut(s) 275, 354
Bst4CI ACNGT 2 cut(s) 157, 297
BstC8I GCNNGC 1 cut(s) 167
BstDEI CTNAG 3 cut(s) 257, 263, 393
BstNSI RCATGY 3 cut(s) 40, 169, 223
BstV2I GAAGAC 1 cut(s) 11
BveI ACCTGC 1 cut(s) 259
Cac8I GCNNGC 1 cut(s) 167
CspCI CAANNNNNGTGG 2 cut(s) 270, 305
CviAII CATG 3 cut(s) 37, 166, 220
CviJI RGCY 2 cut(s) 267, 378
CviKI_1 RGCY 2 cut(s) 267, 378
DdeI CTNAG 3 cut(s) 257, 263, 393
DriI GACNNNNNGTC 1 cut(s) 37
Eam1105I GACNNNNNGTC 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 335
EcoT22I ATGCAT 2 cut(s) 6, 277
FaeI CATG 3 cut(s) 40, 169, 223
FaiI YATR 7 cut(s) 6, 38, 167, 221, 230, 270, 333
FatI CATG 3 cut(s) 36, 165, 219
FspBI CTAG 1 cut(s) 201
Hin1II CATG 3 cut(s) 40, 169, 223
Hpy166II GTNNAC 1 cut(s) 314
Hpy188I TCNGA 1 cut(s) 260
Hpy188III TCNNGA 1 cut(s) 340
Hpy8I GTNNAC 1 cut(s) 314
HpyAV CCTTC 1 cut(s) 8
HpyCH4III ACNGT 2 cut(s) 157, 297
HpyCH4V TGCA 6 cut(s) 4, 36, 254, 275, 305, 347
HpyF3I CTNAG 3 cut(s) 257, 263, 393
Hsp92II CATG 3 cut(s) 40, 169, 223
LmnI GCTCC 2 cut(s) 76, 162
LpnPI CCDG 2 cut(s) 264, 325
LweI GCATC 2 cut(s) 262, 398
MaeI CTAG 1 cut(s) 201
MboII GAAGA 2 cut(s) 11, 416
MluCI AATT 2 cut(s) 102, 335
MnlI CCTC 4 cut(s) 67, 103, 125, 392
Mph1103I ATGCAT 2 cut(s) 6, 277
MroXI GAANNNNTTC 1 cut(s) 18
MseI TTAA 1 cut(s) 63
NlaIII CATG 3 cut(s) 40, 169, 223
NlaIV GGNNCC 1 cut(s) 357
NsiI ATGCAT 2 cut(s) 6, 277
NspI RCATGY 3 cut(s) 40, 169, 223
PaeI GCATGC 1 cut(s) 169
PciI ACATGT 1 cut(s) 219
PdmI GAANNNNTTC 1 cut(s) 18
PscI ACATGT 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 357
SaqAI TTAA 1 cut(s) 63
SetI ASST 4 cut(s) 19, 253, 269, 384
SfaNI GCATC 2 cut(s) 262, 398
SmlI CTYRAG 1 cut(s) 383
SmoI CTYRAG 1 cut(s) 383
SphI GCATGC 1 cut(s) 169
Sse9I AATT 2 cut(s) 102, 335
SspI AATATT 1 cut(s) 244
SspMI CTAG 1 cut(s) 201
TaaI ACNGT 2 cut(s) 157, 297
TasI AATT 2 cut(s) 102, 335
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TspDTI ATGAA 3 cut(s) 201, 348, 417
XapI RAATTY 1 cut(s) 335
XceI RCATGY 3 cut(s) 40, 169, 223
XmnI GAANNNNTTC 1 cut(s) 18
XspI CTAG 1 cut(s) 201
Zsp2I ATGCAT 2 cut(s) 6, 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.