RchiOBHm_Chr2g0121301

complex I intermediate-associated protein 30

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
34216506 .. 34217634
1129 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49385

Sequence Viewer

Length: 246 bp
ATGATCTTCAGAAATCTACCAACATGGAGAGGGATTGTTATCTACTCCGAGATGGAAATCAATCCTCCCATGTTGTTGGCATGTCTCTCTCAGTCAATGCATAAGGTAGGTGTCCCAGGTGCAAAAGCTCGTGTCCCAGGTTTTTGGCCAGGTGATTTCAAGTTGGATGATTTAAGTGCTCATGTGATGTCGTACGATATTTTCGAGAGATTCAGTAGCAATCAAATTTTGTTTTATGGTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.25

Weight (kDa)

6.7

Isoelectric Point (pI)

51.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029773)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0121301
rosa_roxburghii Rroxscaffold_2G00122470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 146
AcsI RAATTY 1 cut(s) 225
AfaI GTAC 1 cut(s) 194
AgsI TTSAA 1 cut(s) 160
AjnI CCWGG 3 cut(s) 115, 136, 148
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw21I GWGCWC 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 89
AoxI GGCC 1 cut(s) 146
ApoI RAATTY 1 cut(s) 225
AsuHPI GGTGA 1 cut(s) 164
BalI TGGCCA 1 cut(s) 148
BauI CACGAG 1 cut(s) 129
Bbv12I GWGCWC 1 cut(s) 181
BccI CCATC 1 cut(s) 46
BciT130I CCWGG 3 cut(s) 117, 138, 150
BcoDI GTCTC 1 cut(s) 89
Bme1390I CCNGG 3 cut(s) 117, 138, 150
BmrFI CCNGG 3 cut(s) 117, 138, 150
BsaBI GATNNNNATC 2 cut(s) 38, 56
BsaJI CCNNGG 2 cut(s) 115, 136
Bse8I GATNNNNATC 2 cut(s) 38, 56
BseBI CCWGG 3 cut(s) 117, 138, 150
BseDI CCNNGG 2 cut(s) 115, 136
BseGI GGATG 1 cut(s) 172
BseJI GATNNNNATC 2 cut(s) 38, 56
BseMII CTCAG 1 cut(s) 104
BshFI GGCC 1 cut(s) 148
BsiHKAI GWGCWC 1 cut(s) 181
BsiWI CGTACG 1 cut(s) 192
BslFI GGGAC 2 cut(s) 98, 119
BsmAI GTCTC 1 cut(s) 89
BsmFI GGGAC 2 cut(s) 98, 119
BsnI GGCC 1 cut(s) 148
Bsp1286I GDGCHC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 1 cut(s) 148
BspCNI CTCAG 1 cut(s) 103
BssECI CCNNGG 2 cut(s) 115, 136
BssMI GATC 1 cut(s) 3
BssSI CACGAG 1 cut(s) 129
Bst2BI CACGAG 1 cut(s) 129
Bst2UI CCWGG 3 cut(s) 117, 138, 150
BstDEI CTNAG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 1 cut(s) 3
BstNI CCWGG 3 cut(s) 117, 138, 150
BstNSI RCATGY 1 cut(s) 84
BstSCI CCNGG 3 cut(s) 115, 136, 148
BstXI CCANNNNNNTGG 2 cut(s) 76, 144
BsuRI GGCC 1 cut(s) 148
BtsCI GGATG 1 cut(s) 172
Csp6I GTAC 1 cut(s) 193
CviAII CATG 4 cut(s) 24, 70, 81, 182
CviJI RGCY 2 cut(s) 128, 148
CviKI_1 RGCY 2 cut(s) 128, 148
CviQI GTAC 1 cut(s) 193
DdeI CTNAG 1 cut(s) 90
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
EaeI YGGCCR 1 cut(s) 146
EcoRII CCWGG 3 cut(s) 115, 136, 148
EcoT22I ATGCAT 1 cut(s) 102
FaeI CATG 4 cut(s) 27, 73, 84, 185
FaiI YATR 6 cut(s) 25, 71, 82, 102, 183, 237
FaqI GGGAC 2 cut(s) 98, 119
FatI CATG 4 cut(s) 23, 69, 80, 181
FokI GGATG 1 cut(s) 179
HaeIII GGCC 1 cut(s) 148
Hin1II CATG 4 cut(s) 27, 73, 84, 185
HinfI GANTC 1 cut(s) 210
HphI GGTGA 1 cut(s) 164
Hpy188I TCNGA 2 cut(s) 11, 49
Hpy188III TCNNGA 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 100, 122
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 4 cut(s) 27, 73, 84, 185
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 6 cut(s) 102, 123, 129, 135, 150, 162
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MhlI GDGCHC 1 cut(s) 181
MlsI TGGCCA 1 cut(s) 148
MluCI AATT 2 cut(s) 225, 241
MluNI TGGCCA 1 cut(s) 148
MmeI TCCRAC 1 cut(s) 144
MnlI CCTC 2 cut(s) 23, 75
Mox20I TGGCCA 1 cut(s) 148
Mph1103I ATGCAT 1 cut(s) 102
MscI TGGCCA 1 cut(s) 148
MseI TTAA 1 cut(s) 173
Msp20I TGGCCA 1 cut(s) 148
MspR9I CCNGG 3 cut(s) 117, 138, 150
MvaI CCWGG 3 cut(s) 117, 138, 150
NdeII GATC 1 cut(s) 3
NlaIII CATG 4 cut(s) 27, 73, 84, 185
NsiI ATGCAT 1 cut(s) 102
NspI RCATGY 1 cut(s) 84
PcsI WCGNNNNNNNCGW 1 cut(s) 201
PfeI GAWTC 1 cut(s) 210
Pfl23II CGTACG 1 cut(s) 192
Psp6I CCWGG 3 cut(s) 115, 136, 148
PspGI CCWGG 3 cut(s) 115, 136, 148
PspLI CGTACG 1 cut(s) 192
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
SaqAI TTAA 1 cut(s) 173
Sau3AI GATC 1 cut(s) 3
ScrFI CCNGG 3 cut(s) 117, 138, 150
SduI GDGCHC 1 cut(s) 181
SetI ASST 6 cut(s) 108, 112, 121, 130, 142, 154
Sse9I AATT 2 cut(s) 225, 241
StyD4I CCNGG 3 cut(s) 115, 136, 148
TaqI TCGA 1 cut(s) 204
TasI AATT 2 cut(s) 225, 241
TfiI GAWTC 1 cut(s) 210
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
XapI RAATTY 1 cut(s) 225
XceI RCATGY 1 cut(s) 84
Zsp2I ATGCAT 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.