RchiOBHm_Chr2g0130371

Golgi to plasma membrane transport

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0029831
Physical Location & Seq
Reverse (-)
46437612 .. 46438221
610 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50184

Sequence Viewer

Length: 171 bp
ATGATACCCATAGCCTTTGTGCAGTCCCTTGCAAATTTAGAGGGTCTGGAAAAAGTTGCTCCTTTTCTCAGGCCAGTAATAGAATTGAAATTCATCAAGTCATTCCTACAGGGTTTTCTTCCTGGGCTTGCCCTTAAAATATTTTTGTACATTCTCCCGACCGTATTATGA

Protein Analysis

56

Amino Acids

6.27

Weight (kDa)

9.4

Isoelectric Point (pI)

50.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RSN1_7TM PF02714 1 - 56 8e-13 Calcium-dependent channel, 7TM region, putative phosphate
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029831)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0130371
rosa_multiflora Rmu_sc0037966.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 34, 89
AfaI GTAC 1 cut(s) 149
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 1 cut(s) 121
AoxI GGCC 1 cut(s) 71
ApoI RAATTY 2 cut(s) 34, 89
BciT130I CCWGG 1 cut(s) 123
BfmI CTRYAG 1 cut(s) 107
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 122
Bse1I ACTGG 1 cut(s) 74
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 122
BseMII CTCAG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 74
BsgI GTGCAG 1 cut(s) 41
Bsh1285I CGRYCG 1 cut(s) 162
BshFI GGCC 1 cut(s) 73
BsiEI CGRYCG 1 cut(s) 162
BslFI GGGAC 1 cut(s) 10
BsmFI GGGAC 1 cut(s) 10
BsnI GGCC 1 cut(s) 73
Bsp1407I TGTACA 1 cut(s) 147
BspANI GGCC 1 cut(s) 73
BspCNI CTCAG 1 cut(s) 81
BsrGI TGTACA 1 cut(s) 147
BsrI ACTGG 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 123
Bst4CI ACNGT 1 cut(s) 163
BstAUI TGTACA 1 cut(s) 147
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 68
BstMCI CGRYCG 1 cut(s) 162
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 107
BsuRI GGCC 1 cut(s) 73
Cac8I GCNNGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 148
CviJI RGCY 3 cut(s) 14, 73, 127
CviKI_1 RGCY 3 cut(s) 14, 73, 127
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 1 cut(s) 68
EcoRII CCWGG 1 cut(s) 121
FaiI YATR 2 cut(s) 11, 169
FaqI GGGAC 1 cut(s) 10
HaeIII GGCC 1 cut(s) 73
Hpy188III TCNNGA 2 cut(s) 47, 157
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4V TGCA 2 cut(s) 22, 32
HpyF3I CTNAG 1 cut(s) 68
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 6 cut(s) 32, 55, 87, 95, 108, 135
MboII GAAGA 1 cut(s) 110
MluCI AATT 3 cut(s) 34, 83, 89
MnlI CCTC 1 cut(s) 34
MseI TTAA 1 cut(s) 135
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 135
ScrFI CCNGG 1 cut(s) 123
SfcI CTRYAG 1 cut(s) 107
SgeI CNNG 9 cut(s) 41, 59, 82, 86, 109, 122, 134, 135, 140
Sse9I AATT 3 cut(s) 34, 83, 89
SspI AATATT 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 121
TaaI ACNGT 1 cut(s) 163
TasI AATT 3 cut(s) 34, 83, 89
TatI WGTACW 1 cut(s) 147
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 82
XapI RAATTY 2 cut(s) 34, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.