RchiOBHm_Chr2g0136611

PKHD-type hydroxylase At1g22950-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
53946929 .. 53951111
4183 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50740

Sequence Viewer

Length: 141 bp
ATGGATTTTGGAGCTTCTGGATTTTCAATCAGAATGAACGCACTATCGAAACAATTTGAAGCTAGAACAGGCGAAGGAAGTTTGGTCTTCAGAGAGCTAAGAAAATATCAGAAAGATTGTTGTAACTGGTGCGGAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.25

Weight (kDa)

7.71

Isoelectric Point (pI)

8.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029814)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0136611
rosa_roxburghii Rroxscaffold_1G00054960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 132
AcuI CTGAAG 1 cut(s) 73
AgsI TTSAA 2 cut(s) 27, 59
AluBI AGCT 3 cut(s) 14, 62, 97
AluI AGCT 3 cut(s) 14, 62, 97
Alw26I GTCTC 1 cut(s) 129
BbsI GAAGAC 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 129
BfaI CTAG 1 cut(s) 63
BpiI GAAGAC 1 cut(s) 79
Bse1I ACTGG 1 cut(s) 131
BseNI ACTGG 1 cut(s) 131
BsmAI GTCTC 1 cut(s) 129
BspACI CCGC 1 cut(s) 132
BsrI ACTGG 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 98
BstMAI GTCTC 1 cut(s) 129
BstV2I GAAGAC 1 cut(s) 79
CviJI RGCY 3 cut(s) 14, 62, 97
CviKI_1 RGCY 3 cut(s) 14, 62, 97
DdeI CTNAG 1 cut(s) 98
Eco57I CTGAAG 1 cut(s) 73
FspBI CTAG 1 cut(s) 63
FspEI CC 6 cut(s) 3, 54, 60, 68, 112, 117
Hpy188I TCNGA 3 cut(s) 32, 92, 111
Hpy188III TCNNGA 1 cut(s) 18
HpyAV CCTTC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 98
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 3 cut(s) 3, 54, 112
MaeI CTAG 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 122
MboII GAAGA 1 cut(s) 79
MluCI AATT 1 cut(s) 53
SetI ASST 3 cut(s) 16, 64, 99
SgeI CNNG 3 cut(s) 30, 75, 81
Sse9I AATT 1 cut(s) 53
SsiI CCGC 1 cut(s) 132
SspMI CTAG 1 cut(s) 63
TaqI TCGA 1 cut(s) 47
TasI AATT 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 50
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.