RchiOBHm_Chr2g0144051

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
61638660 .. 61639542
883 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51406

Sequence Viewer

Length: 336 bp
ATGGCAGATGTTAGGCATAAGAAAGTTGTCCATCGAAAAGGAAATTTTACTGTCCAAGAAGATCAACTCTTGTGTCATTTATATCTTTCAATTTCTCAGCATTCTATCGAAGGTGTTAATCAAAAGAAAGATAAAGTATGGGAAAGGATAACTGATTTGTGGAATAAGGATAAGGATGAACACCAGATGCGAAGCGCCAAGTCTCTTCAAAGTCGATTTTCTGATCTTAATTATTGCATAAGCAAATTTCGTGGTTCACTTCGCCAGGTGGAAAATCGGAATCAAAGTGGTGCTTCAGAGAAAGATATTATGCCCAGGCAAAACAACATCTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

13.16

Weight (kDa)

9.51

Isoelectric Point (pI)

52.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023539)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0144051 RchiOBHm_Chr5g0049061
rosa_samantha Rh2CG424200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 43, 245
AcuI CTGAAG 1 cut(s) 279
AgsI TTSAA 2 cut(s) 90, 209
AjnI CCWGG 2 cut(s) 264, 314
Alw26I GTCTC 1 cut(s) 207
ApoI RAATTY 2 cut(s) 43, 245
AspLEI GCGC 1 cut(s) 197
BccI CCATC 1 cut(s) 39
BciT130I CCWGG 2 cut(s) 266, 316
BcoDI GTCTC 1 cut(s) 207
BfaI CTAG 1 cut(s) 334
BfoI RGCGCY 1 cut(s) 198
Bme1390I CCNGG 2 cut(s) 266, 316
BmrFI CCNGG 2 cut(s) 266, 316
BmsI GCATC 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 314
BseBI CCWGG 2 cut(s) 266, 316
BseDI CCNNGG 1 cut(s) 314
BseGI GGATG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 207
BsmI GAATGC 1 cut(s) 100
Bsp143I GATC 2 cut(s) 61, 223
BspCNI CTCAG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 314
BssMI GATC 2 cut(s) 61, 223
Bst2UI CCWGG 2 cut(s) 266, 316
Bst4CI ACNGT 1 cut(s) 52
Bst6I CTCTTC 1 cut(s) 210
BstDEI CTNAG 1 cut(s) 96
BstF5I GGATG 1 cut(s) 181
BstH2I RGCGCY 1 cut(s) 198
BstHHI GCGC 1 cut(s) 197
BstKTI GATC 2 cut(s) 64, 226
BstMAI GTCTC 1 cut(s) 207
BstMBI GATC 2 cut(s) 61, 223
BstNI CCWGG 2 cut(s) 266, 316
BstSCI CCNGG 2 cut(s) 264, 314
BtsCI GGATG 1 cut(s) 181
CfoI GCGC 1 cut(s) 197
CspCI CAANNNNNGTGG 2 cut(s) 232, 267
DdeI CTNAG 1 cut(s) 96
DpnI GATC 2 cut(s) 63, 225
DpnII GATC 2 cut(s) 61, 223
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Eco57I CTGAAG 1 cut(s) 279
EcoRII CCWGG 2 cut(s) 264, 314
FaiI YATR 5 cut(s) 18, 82, 139, 239, 311
FalI AAGNNNNNCTT 2 cut(s) 277, 309
FokI GGATG 1 cut(s) 188
FspBI CTAG 1 cut(s) 334
GlaI GCGC 1 cut(s) 196
HaeII RGCGCY 1 cut(s) 198
HhaI GCGC 1 cut(s) 197
Hin6I GCGC 1 cut(s) 195
HinP1I GCGC 1 cut(s) 195
HinfI GANTC 1 cut(s) 280
Hpy166II GTNNAC 1 cut(s) 257
Hpy188I TCNGA 3 cut(s) 223, 279, 298
Hpy8I GTNNAC 1 cut(s) 257
HpyAV CCTTC 1 cut(s) 104
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 237
HpyF3I CTNAG 1 cut(s) 96
HspAI GCGC 1 cut(s) 195
Kzo9I GATC 2 cut(s) 61, 223
LpnPI CCDG 5 cut(s) 197, 251, 278, 301, 328
LweI GCATC 1 cut(s) 177
MaeI CTAG 1 cut(s) 334
MalI GATC 2 cut(s) 63, 225
MboI GATC 2 cut(s) 61, 223
MboII GAAGA 2 cut(s) 71, 197
MluCI AATT 4 cut(s) 43, 90, 229, 245
MseI TTAA 2 cut(s) 117, 228
MspR9I CCNGG 2 cut(s) 266, 316
Mva1269I GAATGC 1 cut(s) 100
MvaI CCWGG 2 cut(s) 266, 316
NdeII GATC 2 cut(s) 61, 223
PctI GAATGC 1 cut(s) 100
PfeI GAWTC 1 cut(s) 280
Psp6I CCWGG 2 cut(s) 264, 314
PspGI CCWGG 2 cut(s) 264, 314
SaqAI TTAA 2 cut(s) 117, 228
Sau3AI GATC 2 cut(s) 61, 223
ScrFI CCNGG 2 cut(s) 266, 316
SetI ASST 2 cut(s) 115, 270
SfaNI GCATC 1 cut(s) 177
SgeI CNNG 9 cut(s) 68, 82, 196, 211, 263, 277, 278, 327, 328
Sse9I AATT 4 cut(s) 43, 90, 229, 245
SspMI CTAG 1 cut(s) 334
StyD4I CCNGG 2 cut(s) 264, 314
TaaI ACNGT 1 cut(s) 52
TaqI TCGA 3 cut(s) 34, 108, 214
TasI AATT 4 cut(s) 43, 90, 229, 245
TfiI GAWTC 1 cut(s) 280
Tru1I TTAA 2 cut(s) 117, 228
Tru9I TTAA 2 cut(s) 117, 228
TspDTI ATGAA 1 cut(s) 192
XapI RAATTY 2 cut(s) 43, 245
XspI CTAG 1 cut(s) 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.