Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0029852

Physical Location & Seq

Genomic Coordinates Forward (+)

62981821 .. 62982426

Gene Structure 606 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ51519

Sequence Viewer

CDS Protein Promoter (2k)

Length: 129 bp

ATGCTCAAAGATGAGAGGCTGGTGCAACATCAACCTACGCAATATCCCACATCCGAGGAGTTGAGAATTGGCAAAATCAAGTTCAAGGCCTTTGATTTGGGAGGTCATCAAATTGCTCGCAGGGTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04141 ko05134 map04141 map05134

Pfam Domains

Protein Families

Arf

Protein Analysis

42

Amino Acids

4.94

Weight (kDa)

9.82

Isoelectric Point (pI)

38.48

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Arf	PF00025	1 - 42	1.3e-09	ADP-ribosylation factor family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029852)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0145331 RchiOBHm_Chr7g0225711

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	85
AoxI	GGCC	1 cut(s)	87
BfaI	CTAG	1 cut(s)	127
BsaJI	CCNNGG	1 cut(s)	54
BseDI	CCNNGG	1 cut(s)	54
BseGI	GGATG	1 cut(s)	50
BseRI	GAGGAG	1 cut(s)	71
BshFI	GGCC	1 cut(s)	89
BsnI	GGCC	1 cut(s)	89
BspANI	GGCC	1 cut(s)	89
BssECI	CCNNGG	1 cut(s)	54
BstC8I	GCNNGC	1 cut(s)	118
BstF5I	GGATG	1 cut(s)	50
BsuRI	GGCC	1 cut(s)	89
BtsCI	GGATG	1 cut(s)	50
Cac8I	GCNNGC	1 cut(s)	118
CviJI	RGCY	2 cut(s)	19, 89
CviKI_1	RGCY	2 cut(s)	19, 89
Eco147I	AGGCCT	1 cut(s)	89
FokI	GGATG	1 cut(s)	37
FspBI	CTAG	1 cut(s)	127
HaeIII	GGCC	1 cut(s)	89
Hpy188I	TCNGA	1 cut(s)	55
HpyCH4V	TGCA	1 cut(s)	25
LpnPI	CCDG	2 cut(s)	5, 106
MaeI	CTAG	1 cut(s)	127
MluCI	AATT	2 cut(s)	66, 111
MnlI	CCTC	3 cut(s)	9, 49, 95
PceI	AGGCCT	1 cut(s)	89
SetI	ASST	2 cut(s)	37, 106
SgeI	CNNG	4 cut(s)	32, 67, 91, 97
Sse9I	AATT	2 cut(s)	66, 111
SseBI	AGGCCT	1 cut(s)	89
SspMI	CTAG	1 cut(s)	127
StuI	AGGCCT	1 cut(s)	89
TasI	AATT	2 cut(s)	66, 111
XspI	CTAG	1 cut(s)	127

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.