RchiOBHm_Chr2g0150231

Rhamnogalacturonate lyase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
67935970 .. 67936179
210 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51958

Sequence Viewer

Length: 210 bp
ATGGAAAAGGTTTTCTGTCCTGTTTTTGTCTATCTTAATTCTGCTCCACCGGAATCAAATAATTCCACGAGTATTCTCTGGAACAATGCTAAACAACAAATGTTCAAAGAAGTCAAGAGTTGGCCATACAATTTCACTCAGTCTCAAGACTTTCCTTCTTCTGATCAAAGGGGTTCACTGTCCTGCCGATTACTAGTACATGATCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.03

Weight (kDa)

7.8

Isoelectric Point (pI)

54.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021339)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0150231
rosa_laevigata RLG00000020480
rosa_multiflora Rmu_ssc0000020.1_g000006
rosa_samantha Rh2BG491300 Rh2DG500100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 122
AfaI GTAC 1 cut(s) 198
AgsI TTSAA 1 cut(s) 106
AhlI ACTAGT 1 cut(s) 193
Alw26I GTCTC 1 cut(s) 147
AoxI GGCC 1 cut(s) 122
BalI TGGCCA 1 cut(s) 124
BauI CACGAG 1 cut(s) 67
BclI TGATCA 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 147
BcuI ACTAGT 1 cut(s) 193
BfaI CTAG 1 cut(s) 194
BpuEI CTTGAG 1 cut(s) 129
BsaWI WCCGGW 1 cut(s) 49
BseMII CTCAG 1 cut(s) 152
BshFI GGCC 1 cut(s) 124
BsiSI CCGG 1 cut(s) 50
BsmAI GTCTC 1 cut(s) 147
BsnI GGCC 1 cut(s) 124
Bsp143I GATC 2 cut(s) 163, 202
BspANI GGCC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 151
BssMI GATC 2 cut(s) 163, 202
BssSI CACGAG 1 cut(s) 67
Bst2BI CACGAG 1 cut(s) 67
Bst4CI ACNGT 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 138
BstKTI GATC 2 cut(s) 166, 205
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 2 cut(s) 163, 202
BsuRI GGCC 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 176
Csp6I GTAC 1 cut(s) 197
CviAII CATG 1 cut(s) 200
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
CviQI GTAC 1 cut(s) 197
DdeI CTNAG 1 cut(s) 138
DpnI GATC 2 cut(s) 165, 204
DpnII GATC 2 cut(s) 163, 202
EaeI YGGCCR 1 cut(s) 122
FaeI CATG 1 cut(s) 203
FaiI YATR 2 cut(s) 127, 201
FatI CATG 1 cut(s) 199
FbaI TGATCA 1 cut(s) 163
FspBI CTAG 1 cut(s) 194
HaeIII GGCC 1 cut(s) 124
HapII CCGG 1 cut(s) 50
Hin1II CATG 1 cut(s) 203
HinfI GANTC 1 cut(s) 53
HpaII CCGG 1 cut(s) 50
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 163
Hpy188III TCNNGA 3 cut(s) 79, 115, 146
Hpy8I GTNNAC 1 cut(s) 176
HpyAV CCTTC 1 cut(s) 165
HpyCH4III ACNGT 1 cut(s) 180
HpyF3I CTNAG 1 cut(s) 138
Hsp92II CATG 1 cut(s) 203
Ksp22I TGATCA 1 cut(s) 163
Kzo9I GATC 2 cut(s) 163, 202
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 4 cut(s) 33, 63, 64, 196
MaeI CTAG 1 cut(s) 194
MalI GATC 2 cut(s) 165, 204
MboI GATC 2 cut(s) 163, 202
MboII GAAGA 1 cut(s) 150
MlsI TGGCCA 1 cut(s) 124
MluCI AATT 3 cut(s) 37, 61, 130
MluNI TGGCCA 1 cut(s) 124
Mox20I TGGCCA 1 cut(s) 124
MscI TGGCCA 1 cut(s) 124
MseI TTAA 1 cut(s) 36
Msp20I TGGCCA 1 cut(s) 124
MspI CCGG 1 cut(s) 50
NdeII GATC 2 cut(s) 163, 202
NlaIII CATG 1 cut(s) 203
PfeI GAWTC 1 cut(s) 53
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
SaqAI TTAA 1 cut(s) 36
Sau3AI GATC 2 cut(s) 163, 202
SetI ASST 1 cut(s) 12
SgeI CNNG 9 cut(s) 32, 62, 79, 81, 91, 127, 158, 195, 206
SmlI CTYRAG 1 cut(s) 144
SmoI CTYRAG 1 cut(s) 144
SpeI ACTAGT 1 cut(s) 193
Sse9I AATT 3 cut(s) 37, 61, 130
SspMI CTAG 1 cut(s) 194
TaaI ACNGT 1 cut(s) 180
TasI AATT 3 cut(s) 37, 61, 130
TatI WGTACW 1 cut(s) 196
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TscAI CASTG 1 cut(s) 183
TspRI CASTG 1 cut(s) 183
XspI CTAG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.