RchiOBHm_Chr2g0157261

importin-7 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
73706579 .. 73707074
496 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52600

Sequence Viewer

Length: 207 bp
ATGAGCCAGAAATTTTGTTCCTTATTTGTTGGTGATCTAATGTCATTGTACAGGGTACAACTAGGTGAGTGCCTAAAGACAATTATTTATGTTGATTACCCTGAGCGGTGGCCACGACTTTTAGACTGGGTGAAGCACAACTTGCAAGACCAACAAGTTCATGGAGCTTTGTTAGTTTTGCAGATTCTTTCTAGAAAACAAGAGTAA

Protein Analysis

68

Amino Acids

8.09

Weight (kDa)

7.81

Isoelectric Point (pI)

63.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024851)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0157261
rosa_samantha Rh2BG538700 Rh2DG547700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 106
AciI CCGC 1 cut(s) 106
AcoI YGGCCR 1 cut(s) 110
AcsI RAATTY 1 cut(s) 11
AfaI GTAC 2 cut(s) 50, 57
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
AoxI GGCC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 11
AsuHPI GGTGA 3 cut(s) 44, 77, 142
BalI TGGCCA 1 cut(s) 112
BfaI CTAG 2 cut(s) 62, 192
BmrI ACTGGG 1 cut(s) 136
BmuI ACTGGG 1 cut(s) 136
Bpu10I CCTNAGC 1 cut(s) 102
Bse1I ACTGG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 131
BshFI GGCC 1 cut(s) 112
BsnI GGCC 1 cut(s) 112
Bsp1407I TGTACA 1 cut(s) 48
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 1 cut(s) 106
BspANI GGCC 1 cut(s) 112
BspCNI CTCAG 1 cut(s) 94
BsrBI CCGCTC 1 cut(s) 106
BsrGI TGTACA 1 cut(s) 48
BsrI ACTGG 1 cut(s) 131
BssMI GATC 1 cut(s) 34
BstAPI GCANNNNNTGC 1 cut(s) 142
BstAUI TGTACA 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 142
BsuRI GGCC 1 cut(s) 112
Csp6I GTAC 2 cut(s) 49, 56
CviAII CATG 1 cut(s) 161
CviJI RGCY 3 cut(s) 6, 112, 167
CviKI_1 RGCY 3 cut(s) 6, 112, 167
CviQI GTAC 2 cut(s) 49, 56
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
EaeI YGGCCR 1 cut(s) 110
FaeI CATG 1 cut(s) 164
FaiI YATR 2 cut(s) 90, 162
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FatI CATG 1 cut(s) 160
FspBI CTAG 2 cut(s) 62, 192
HaeIII GGCC 1 cut(s) 112
Hin1II CATG 1 cut(s) 164
HinfI GANTC 1 cut(s) 184
HphI GGTGA 3 cut(s) 44, 77, 142
Hpy188III TCNNGA 1 cut(s) 192
HpyCH4V TGCA 2 cut(s) 145, 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 142
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 1 cut(s) 164
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 164
LpnPI CCDG 4 cut(s) 20, 37, 112, 114
MaeI CTAG 2 cut(s) 62, 192
MalI GATC 1 cut(s) 36
MbiI CCGCTC 1 cut(s) 106
MboI GATC 1 cut(s) 34
MlsI TGGCCA 1 cut(s) 112
MluCI AATT 2 cut(s) 11, 81
MluNI TGGCCA 1 cut(s) 112
Mox20I TGGCCA 1 cut(s) 112
MscI TGGCCA 1 cut(s) 112
Msp20I TGGCCA 1 cut(s) 112
MwoI GCNNNNNNNGC 1 cut(s) 142
NdeII GATC 1 cut(s) 34
NlaIII CATG 1 cut(s) 164
PfeI GAWTC 1 cut(s) 184
RsaI GTAC 2 cut(s) 50, 57
RsaNI GTAC 2 cut(s) 49, 56
Sau3AI GATC 1 cut(s) 34
SetI ASST 2 cut(s) 67, 169
Sse9I AATT 2 cut(s) 11, 81
SsiI CCGC 1 cut(s) 106
SspMI CTAG 2 cut(s) 62, 192
TasI AATT 2 cut(s) 11, 81
TatI WGTACW 1 cut(s) 48
TfiI GAWTC 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 149
XapI RAATTY 1 cut(s) 11
XbaI TCTAGA 1 cut(s) 191
XcmI CCANNNNNNNNNTGG 1 cut(s) 158
XspI CTAG 2 cut(s) 62, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.