RchiOBHm_Chr2g0159741

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
75798159 .. 75799081
923 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52830

Sequence Viewer

Length: 174 bp
ATGAGTTACTTGAAACTTGGAATTATGAACTTGTCCTCGAGTGGATTGCCAGGAGAGATAACTTCATGTATATCCAATCTTGACATGTTACATCTCTGTAGGTATTCCAAGCTTGACAACTTAGCAATAGCTGACTTTATGTGCGCATATATCTGCAGTAATTTTATAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.31

Weight (kDa)

5.41

Isoelectric Point (pI)

22.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024836)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0097741 RchiOBHm_Chr2g0159741
rosa_samantha Rh4CG118700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 167
Acc16I TGCGCA 1 cut(s) 145
AflIII ACRYGT 1 cut(s) 84
AgsI TTSAA 1 cut(s) 13
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 2 cut(s) 112, 131
AluI AGCT 2 cut(s) 112, 131
Ama87I CYCGRG 1 cut(s) 37
AspLEI GCGC 1 cut(s) 146
AvaI CYCGRG 1 cut(s) 37
BcgI CGANNNNNNTGC 2 cut(s) 28, 62
BciT130I CCWGG 1 cut(s) 51
BfmI CTRYAG 2 cut(s) 97, 154
Bme1390I CCNGG 1 cut(s) 51
BmeT110I CYCGRG 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 51
BsiHKCI CYCGRG 1 cut(s) 37
BsoBI CYCGRG 1 cut(s) 37
BspMAI CTGCAG 1 cut(s) 158
Bst2UI CCWGG 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 121
BstHHI GCGC 1 cut(s) 146
BstNI CCWGG 1 cut(s) 51
BstNSI RCATGY 1 cut(s) 88
BstSCI CCNGG 1 cut(s) 49
BstSFI CTRYAG 2 cut(s) 97, 154
CfoI GCGC 1 cut(s) 146
CviAII CATG 2 cut(s) 66, 85
CviJI RGCY 2 cut(s) 112, 131
CviKI_1 RGCY 2 cut(s) 112, 131
DdeI CTNAG 1 cut(s) 121
Eco88I CYCGRG 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 49
FaeI CATG 2 cut(s) 69, 88
FaiI YATR 8 cut(s) 26, 67, 71, 86, 140, 148, 150, 167
FatI CATG 2 cut(s) 65, 84
FspAI RTGCGCAY 1 cut(s) 145
FspEI CC 8 cut(s) 3, 27, 36, 49, 63, 85, 88, 121
FspI TGCGCA 1 cut(s) 145
GlaI GCGC 1 cut(s) 145
HhaI GCGC 1 cut(s) 146
Hin1II CATG 2 cut(s) 69, 88
Hin6I GCGC 1 cut(s) 144
HinP1I GCGC 1 cut(s) 144
HindIII AAGCTT 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 156
HpyF3I CTNAG 1 cut(s) 121
Hsp92II CATG 2 cut(s) 69, 88
HspAI GCGC 1 cut(s) 144
LpnPI CCDG 2 cut(s) 36, 63
MaeIII GTNAC 2 cut(s) 5, 87
MluCI AATT 3 cut(s) 21, 160, 169
MnlI CCTC 1 cut(s) 46
MseI TTAA 1 cut(s) 172
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
NlaIII CATG 2 cut(s) 69, 88
NsbI TGCGCA 1 cut(s) 145
NspI RCATGY 1 cut(s) 88
PaeR7I CTCGAG 1 cut(s) 37
PciI ACATGT 1 cut(s) 84
PscI ACATGT 1 cut(s) 84
PsiI TTATAA 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PspXI VCTCGAGB 1 cut(s) 37
PstI CTGCAG 1 cut(s) 158
SaqAI TTAA 1 cut(s) 172
ScrFI CCNGG 1 cut(s) 51
SetI ASST 3 cut(s) 104, 114, 133
SfcI CTRYAG 2 cut(s) 97, 154
Sfr274I CTCGAG 1 cut(s) 37
SlaI CTCGAG 1 cut(s) 37
SmlI CTYRAG 1 cut(s) 37
SmoI CTYRAG 1 cut(s) 37
Sse9I AATT 3 cut(s) 21, 160, 169
StyD4I CCNGG 1 cut(s) 49
TaqI TCGA 1 cut(s) 38
TasI AATT 3 cut(s) 21, 160, 169
Tru1I TTAA 1 cut(s) 172
Tru9I TTAA 1 cut(s) 172
TspDTI ATGAA 2 cut(s) 41, 54
XceI RCATGY 1 cut(s) 88
XhoI CTCGAG 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.