RchiOBHm_Chr3g0475551

Chaperone protein DNAj

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
21395419 .. 21397016
1598 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44105

Sequence Viewer

Length: 264 bp
ATGGTTATGTATCATCAAGACAAGAATATGAACAATCCTAAAGCGGTAGAACAGTTGAAGGAGGTTGCATTTTCATATAGCATCTTATCTGACCCAAAGAAGGGGAGTGACTTTTCTAGAAAAACTCAAAGCAATTTCACTTATATCAGTTTTGAGCTACTCTTCCTGTTGTTTTGTATATTAATTTCACTTCAGCAGTCTCTCAGGTACTTACATATTCTCCCTCTTTCTGCATTTTGGGGTTTCATATTGTTTTTATATTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

10.28

Weight (kDa)

8.79

Isoelectric Point (pI)

46.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024214)

Species Orthologous Gene IDs
malus_domestica MD10G1298800.v1.1
rosa_chinensis RchiOBHm_Chr3g0475551
rosa_rugosa Rorug01G0401500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AcuI CTGAAG 1 cut(s) 176
AfaI GTAC 1 cut(s) 209
AfiI CCNNNNNNNGG 2 cut(s) 100, 101
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
Alw26I GTCTC 1 cut(s) 204
AseI ATTAAT 1 cut(s) 182
BcoDI GTCTC 1 cut(s) 204
BfaI CTAG 1 cut(s) 117
BmsI GCATC 1 cut(s) 90
BsaXI ACNNNNNCTCC 2 cut(s) 204, 234
Bsc4I CCNNNNNNNGG 2 cut(s) 100, 101
BseLI CCNNNNNNNGG 2 cut(s) 100, 101
BseMII CTCAG 1 cut(s) 217
BslI CCNNNNNNNGG 2 cut(s) 100, 101
BsmAI GTCTC 1 cut(s) 204
BspACI CCGC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 216
Bst4CI ACNGT 1 cut(s) 54
Bst6I CTCTTC 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 203
BstMAI GTCTC 1 cut(s) 204
Csp6I GTAC 1 cut(s) 208
CviJI RGCY 1 cut(s) 157
CviKI_1 RGCY 1 cut(s) 157
CviQI GTAC 1 cut(s) 208
DdeI CTNAG 1 cut(s) 203
Eam1104I CTCTTC 1 cut(s) 167
EarI CTCTTC 1 cut(s) 167
Eco57I CTGAAG 1 cut(s) 176
FaiI YATR 9 cut(s) 8, 29, 76, 78, 144, 179, 216, 248, 259
FspBI CTAG 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 17, 117
HpyAV CCTTC 2 cut(s) 52, 94
HpyCH4III ACNGT 1 cut(s) 54
HpyCH4V TGCA 2 cut(s) 68, 233
HpyF3I CTNAG 1 cut(s) 203
LpnPI CCDG 2 cut(s) 179, 190
LweI GCATC 1 cut(s) 90
MaeI CTAG 1 cut(s) 117
MaeIII GTNAC 1 cut(s) 107
MboII GAAGA 1 cut(s) 154
MluCI AATT 2 cut(s) 133, 183
MnlI CCTC 2 cut(s) 55, 234
MseI TTAA 1 cut(s) 182
NmuCI GTSAC 1 cut(s) 107
PshBI ATTAAT 1 cut(s) 182
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
SaqAI TTAA 1 cut(s) 182
SetI ASST 3 cut(s) 66, 159, 209
SfaNI GCATC 1 cut(s) 90
SgeI CNNG 5 cut(s) 29, 34, 129, 178, 217
Sse9I AATT 2 cut(s) 133, 183
SsiI CCGC 1 cut(s) 44
SspMI CTAG 1 cut(s) 117
TaaI ACNGT 1 cut(s) 54
TasI AATT 2 cut(s) 133, 183
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 3 cut(s) 44, 63, 235
VspI ATTAAT 1 cut(s) 182
XbaI TCTAGA 1 cut(s) 116
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.