RchiOBHm_Chr3g0477641

Methionine adenosyltransferase 2 subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
23569575 .. 23572094
2520 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44295

Sequence Viewer

Length: 177 bp
ATGGAAGAACCTTTCTCCATGGATTTGAAGACTGGCAATGGATTTGAAGCCATATCTCATCAGTTTGGTCCGCCTGATGTGGTAGTAAACTGTGCTGCACTTTCGGTTCCTCGTGCCTGTACAATGGATCCTGCTGCAGCTATGTCAGTTAATGTGCCATCTTCTCTTGTTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.05

Weight (kDa)

4.29

Isoelectric Point (pI)

51.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024928)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0477641
rosa_samantha Rh2AG644100 Rh2BG654900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 71
AclWI GGATC 2 cut(s) 122, 135
AfaI GTAC 1 cut(s) 121
AgsI TTSAA 2 cut(s) 28, 47
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AlwI GGATC 2 cut(s) 122, 135
ApeKI GCWGC 3 cut(s) 95, 134, 137
AspS9I GGNCC 1 cut(s) 68
AvaII GGWCC 1 cut(s) 68
BamHI GGATCC 1 cut(s) 127
BauI CACGAG 1 cut(s) 111
BbsI GAAGAC 1 cut(s) 35
BbvI GCAGC 3 cut(s) 82, 121, 149
BccI CCATC 1 cut(s) 166
BfmI CTRYAG 1 cut(s) 135
BisI GCNGC 3 cut(s) 96, 135, 138
BlsI GCNGC 3 cut(s) 97, 136, 139
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 68
BmiI GGNNCC 2 cut(s) 108, 129
BpiI GAAGAC 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 18
Bse1I ACTGG 1 cut(s) 37
Bse3DI GCAATG 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 18
BseMI GCAATG 1 cut(s) 43
BseNI ACTGG 1 cut(s) 37
BseXI GCAGC 3 cut(s) 82, 121, 149
BsgI GTGCAG 1 cut(s) 81
Bsp1407I TGTACA 1 cut(s) 119
Bsp143I GATC 1 cut(s) 127
Bsp19I CCATGG 1 cut(s) 18
BspACI CCGC 1 cut(s) 71
BspLI GGNNCC 2 cut(s) 108, 129
BspMAI CTGCAG 1 cut(s) 139
BspPI GGATC 2 cut(s) 122, 135
BsrDI GCAATG 1 cut(s) 43
BsrGI TGTACA 1 cut(s) 119
BsrI ACTGG 1 cut(s) 37
BssECI CCNNGG 1 cut(s) 18
BssMI GATC 1 cut(s) 127
BssSI CACGAG 1 cut(s) 111
BssT1I CCWWGG 1 cut(s) 18
Bst2BI CACGAG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 92
BstAUI TGTACA 1 cut(s) 119
BstDSI CCRYGG 1 cut(s) 18
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstSFI CTRYAG 1 cut(s) 135
BstV1I GCAGC 3 cut(s) 82, 121, 149
BstV2I GAAGAC 1 cut(s) 35
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BtgI CCRYGG 1 cut(s) 18
Cfr13I GGNCC 1 cut(s) 68
Csp6I GTAC 1 cut(s) 120
CviAII CATG 1 cut(s) 19
CviJI RGCY 2 cut(s) 50, 140
CviKI_1 RGCY 2 cut(s) 50, 140
CviQI GTAC 1 cut(s) 120
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
EciI GGCGGA 1 cut(s) 60
Eco130I CCWWGG 1 cut(s) 18
Eco47I GGWCC 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 18
FaeI CATG 1 cut(s) 22
FaiI YATR 3 cut(s) 20, 53, 143
FatI CATG 1 cut(s) 18
Fnu4HI GCNGC 3 cut(s) 96, 135, 138
Fsp4HI GCNGC 3 cut(s) 96, 135, 138
GluI GCNGC 3 cut(s) 96, 135, 138
Hin1II CATG 1 cut(s) 22
Hpy166II GTNNAC 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 98, 137
Hsp92II CATG 1 cut(s) 22
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 4 cut(s) 18, 87, 130, 144
Lsp1109I GCAGC 3 cut(s) 82, 121, 149
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 3 cut(s) 17, 40, 153
MflI RGATCY 1 cut(s) 127
MluCI AATT 1 cut(s) 172
MnlI CCTC 1 cut(s) 120
MseI TTAA 2 cut(s) 150, 171
NcoI CCATGG 1 cut(s) 18
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 22
NlaIV GGNNCC 2 cut(s) 108, 129
PkrI GCNGC 3 cut(s) 97, 136, 139
PspN4I GGNNCC 2 cut(s) 108, 129
PspPI GGNCC 1 cut(s) 68
PstI CTGCAG 1 cut(s) 139
PsuI RGATCY 1 cut(s) 127
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 150, 171
SatI GCNGC 3 cut(s) 96, 135, 138
Sau3AI GATC 1 cut(s) 127
Sau96I GGNCC 1 cut(s) 68
SetI ASST 2 cut(s) 13, 142
SfcI CTRYAG 1 cut(s) 135
SgeI CNNG 7 cut(s) 31, 45, 86, 123, 125, 129, 143
SinI GGWCC 1 cut(s) 68
Sse9I AATT 1 cut(s) 172
SsiI CCGC 1 cut(s) 71
StyI CCWWGG 1 cut(s) 18
TaaI ACNGT 1 cut(s) 92
TasI AATT 1 cut(s) 172
TatI WGTACW 1 cut(s) 119
Tru1I TTAA 2 cut(s) 150, 171
Tru9I TTAA 2 cut(s) 150, 171
TseI GCWGC 3 cut(s) 95, 134, 137
VpaK11BI GGWCC 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.