Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0029941

Physical Location & Seq

Genomic Coordinates Reverse (-)

25986682 .. 25987580

Gene Structure 899 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ44526

Sequence Viewer

CDS Protein Promoter (2k)

Length: 135 bp

ATGCTATCTGATGTTTCCTTGGCCATTTCATTGCTGACAACTAGGAAAACACGGGACTTGATCATGATTCTCAACTCCAAAAGATTCCTAGACAGATCGATTAGTGAGTTCATAGGAAGAAAAGAAACATCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000079 GO:0001932 GO:0005575 GO:0005623 GO:0007346 GO:0008150 GO:0012505 GO:0019220 GO:0019222 GO:0031323 GO:0031399 GO:0032268 GO:0042325 GO:0043549 GO:0044464 GO:0045859 GO:0050789 GO:0050790 GO:0050794 GO:0051171 GO:0051174 GO:0051246 GO:0051338 GO:0051726 GO:0060255 GO:0065007 GO:0065009 GO:0071900 GO:0080090 GO:1904029

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF773

Protein Analysis

44

Amino Acids

5.06

Weight (kDa)

10.25

Isoelectric Point (pI)

34.21

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
CDK5RAP3	PF05600	1 - 39	6.6e-08	CDK5 regulatory subunit-associated protein 3

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029941)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0480231
rosa_samantha	Rh3CG262900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	21
AoxI	GGCC	1 cut(s)	21
BalI	TGGCCA	1 cut(s)	23
BclI	TGATCA	1 cut(s)	60
BfaI	CTAG	2 cut(s)	42, 89
Bsa29I	ATCGAT	1 cut(s)	98
BsaJI	CCNNGG	1 cut(s)	18
Bse3DI	GCAATG	1 cut(s)	29
BseCI	ATCGAT	1 cut(s)	98
BseDI	CCNNGG	1 cut(s)	18
BseMI	GCAATG	1 cut(s)	29
BshFI	GGCC	1 cut(s)	23
BshVI	ATCGAT	1 cut(s)	98
BslFI	GGGAC	1 cut(s)	68
BsmFI	GGGAC	1 cut(s)	68
BsnI	GGCC	1 cut(s)	23
Bsp143I	GATC	2 cut(s)	60, 95
BspANI	GGCC	1 cut(s)	23
BspDI	ATCGAT	1 cut(s)	98
BspHI	TCATGA	2 cut(s)	63, 131
BsrDI	GCAATG	1 cut(s)	29
BssECI	CCNNGG	1 cut(s)	18
BssMI	GATC	2 cut(s)	60, 95
BssT1I	CCWWGG	1 cut(s)	18
BstKTI	GATC	2 cut(s)	63, 98
BstMBI	GATC	2 cut(s)	60, 95
Bsu15I	ATCGAT	1 cut(s)	98
BsuRI	GGCC	1 cut(s)	23
BsuTUI	ATCGAT	1 cut(s)	98
CciI	TCATGA	2 cut(s)	63, 131
ClaI	ATCGAT	1 cut(s)	98
CviAII	CATG	2 cut(s)	64, 132
CviJI	RGCY	1 cut(s)	23
CviKI_1	RGCY	1 cut(s)	23
DpnI	GATC	2 cut(s)	62, 97
DpnII	GATC	2 cut(s)	60, 95
EaeI	YGGCCR	1 cut(s)	21
Eco130I	CCWWGG	1 cut(s)	18
EcoT14I	CCWWGG	1 cut(s)	18
ErhI	CCWWGG	1 cut(s)	18
FaeI	CATG	2 cut(s)	67, 135
FaiI	YATR	3 cut(s)	65, 113, 133
FaqI	GGGAC	1 cut(s)	68
FatI	CATG	2 cut(s)	63, 131
FbaI	TGATCA	1 cut(s)	60
FspBI	CTAG	2 cut(s)	42, 89
FspEI	CC	9 cut(s)	5, 28, 31, 37, 37, 38, 91, 99, 101
HaeIII	GGCC	1 cut(s)	23
Hin1II	CATG	2 cut(s)	67, 135
HinfI	GANTC	2 cut(s)	67, 84
Hpy188I	TCNGA	1 cut(s)	10
Hpy188III	TCNNGA	2 cut(s)	64, 132
Hsp92II	CATG	2 cut(s)	67, 135
Ksp22I	TGATCA	1 cut(s)	60
Kzo9I	GATC	2 cut(s)	60, 95
MaeI	CTAG	2 cut(s)	42, 89
MalI	GATC	2 cut(s)	62, 97
MboI	GATC	2 cut(s)	60, 95
MboII	GAAGA	1 cut(s)	129
MlsI	TGGCCA	1 cut(s)	23
MluNI	TGGCCA	1 cut(s)	23
Mox20I	TGGCCA	1 cut(s)	23
MscI	TGGCCA	1 cut(s)	23
Msp20I	TGGCCA	1 cut(s)	23
NdeII	GATC	2 cut(s)	60, 95
NlaIII	CATG	2 cut(s)	67, 135
PagI	TCATGA	2 cut(s)	63, 131
PfeI	GAWTC	2 cut(s)	67, 84
Sau3AI	GATC	2 cut(s)	60, 95
SgeI	CNNG	7 cut(s)	31, 54, 63, 65, 70, 76, 101
SspMI	CTAG	2 cut(s)	42, 89
StyI	CCWWGG	1 cut(s)	18
TaqI	TCGA	1 cut(s)	98
TfiI	GAWTC	2 cut(s)	67, 84
TspDTI	ATGAA	2 cut(s)	18, 100
XspI	CTAG	2 cut(s)	42, 89

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.