RchiOBHm_Chr3g0486951

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
34033179 .. 34033340
162 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45139

Sequence Viewer

Length: 162 bp
ATGTTATTTAACAAGAAACAACTAGAAAAGCTAAAGCGGCATATTCGAAATAAGGAATCACAACGTGCCGCTCACAACTCTCCCAACTCCATGATCAAAATAGTTAGAAAGAAAGGGATTTTTGTGTTTGGTTATCTTTTGCTTTGGGATCTTGGTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.31

Weight (kDa)

10.51

Isoelectric Point (pI)

53.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024901)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0486951
rosa_laevigata RLG00000009754
rosa_samantha Rh4BG042900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 71
AciI CCGC 2 cut(s) 37, 69
AclWI GGATC 1 cut(s) 156
AdeI CACNNNGTG 1 cut(s) 65
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
AlwI GGATC 1 cut(s) 156
AsuII TTCGAA 1 cut(s) 46
BclI TGATCA 1 cut(s) 93
BfaI CTAG 1 cut(s) 23
BisI GCNGC 2 cut(s) 38, 69
BlsI GCNGC 2 cut(s) 39, 70
Bpu14I TTCGAA 1 cut(s) 46
Bsp119I TTCGAA 1 cut(s) 46
Bsp143I GATC 2 cut(s) 93, 148
BspACI CCGC 2 cut(s) 37, 69
BspPI GGATC 1 cut(s) 156
BspT104I TTCGAA 1 cut(s) 46
BsrBI CCGCTC 1 cut(s) 71
BssMI GATC 2 cut(s) 93, 148
BstBI TTCGAA 1 cut(s) 46
BstKTI GATC 2 cut(s) 96, 151
BstMBI GATC 2 cut(s) 93, 148
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstX2I RGATCY 1 cut(s) 148
BstYI RGATCY 1 cut(s) 148
CviAII CATG 1 cut(s) 91
CviJI RGCY 1 cut(s) 31
CviKI_1 RGCY 1 cut(s) 31
DpnI GATC 2 cut(s) 95, 150
DpnII GATC 2 cut(s) 93, 148
DraIII CACNNNGTG 1 cut(s) 65
FaeI CATG 1 cut(s) 94
FaiI YATR 2 cut(s) 42, 92
FatI CATG 1 cut(s) 90
FbaI TGATCA 1 cut(s) 93
Fnu4HI GCNGC 2 cut(s) 38, 69
Fsp4HI GCNGC 2 cut(s) 38, 69
FspBI CTAG 1 cut(s) 23
GluI GCNGC 2 cut(s) 38, 69
Hin1II CATG 1 cut(s) 94
HinfI GANTC 1 cut(s) 56
HpyCH4IV ACGT 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpySE526I ACGT 1 cut(s) 64
Hsp92II CATG 1 cut(s) 94
Ksp22I TGATCA 1 cut(s) 93
Kzo9I GATC 2 cut(s) 93, 148
MaeI CTAG 1 cut(s) 23
MaeII ACGT 1 cut(s) 64
MalI GATC 2 cut(s) 95, 150
MbiI CCGCTC 1 cut(s) 71
MboI GATC 2 cut(s) 93, 148
MflI RGATCY 1 cut(s) 148
MseI TTAA 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 2 cut(s) 93, 148
NlaIII CATG 1 cut(s) 94
NspV TTCGAA 1 cut(s) 46
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 2 cut(s) 39, 70
PsuI RGATCY 1 cut(s) 148
SaqAI TTAA 1 cut(s) 9
SatI GCNGC 2 cut(s) 38, 69
Sau3AI GATC 2 cut(s) 93, 148
SetI ASST 2 cut(s) 33, 67
SfuI TTCGAA 1 cut(s) 46
SgeI CNNG 4 cut(s) 25, 35, 77, 103
SsiI CCGC 2 cut(s) 37, 69
SspMI CTAG 1 cut(s) 23
TaiI ACGT 1 cut(s) 67
TaqI TCGA 1 cut(s) 46
TauI GCSGC 2 cut(s) 40, 71
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.