RchiOBHm_Chr4g0388401

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
3630173 .. 3632125
1953 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36163

Sequence Viewer

Length: 252 bp
ATGAAAGTTAAGATGATTACATGTTTAAATACAGTGATGGCATCAAAAGGTATTTCGAGAGGAACAAAGAGAATATTAAGAGAGTATGATGTTGAAAGTCGTGATAGTCAAGAAAAGATTCAACAAATTTGTACTACTCAAAACTCTGCTGTGAGAAGAACTGAATCTGATCATTTATGTTTTGGTGGGAATGAGGATCGTCCAGTTAACTCAAAGAGGTGGAAAACATGTACGTGTATCTTATGTATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.51

Weight (kDa)

9.24

Isoelectric Point (pI)

75.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022717)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0388401 RchiOBHm_Chr4g0413131
rosa_samantha Rh2AG296100 Rh4CG023000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 204
AcsI RAATTY 1 cut(s) 126
AfaI GTAC 2 cut(s) 133, 232
AflIII ACRYGT 3 cut(s) 20, 227, 233
AgsI TTSAA 2 cut(s) 95, 122
AlwI GGATC 1 cut(s) 204
ApoI RAATTY 1 cut(s) 126
Asp700I GAANNNNTTC 1 cut(s) 117
BccI CCATC 1 cut(s) 31
BclI TGATCA 1 cut(s) 169
BmsI GCATC 1 cut(s) 50
BsaAI YACGTR 1 cut(s) 234
Bse1I ACTGG 1 cut(s) 203
BseNI ACTGG 1 cut(s) 203
Bsp143I GATC 2 cut(s) 169, 196
BspPI GGATC 1 cut(s) 204
BsrI ACTGG 1 cut(s) 203
BssMI GATC 2 cut(s) 169, 196
Bst4CI ACNGT 1 cut(s) 34
BstBAI YACGTR 1 cut(s) 234
BstKTI GATC 2 cut(s) 172, 199
BstMBI GATC 2 cut(s) 169, 196
BstNSI RCATGY 2 cut(s) 24, 231
BtsIMutI CAGTG 1 cut(s) 39
Csp6I GTAC 2 cut(s) 132, 231
CviAII CATG 2 cut(s) 21, 228
CviQI GTAC 2 cut(s) 132, 231
DpnI GATC 2 cut(s) 171, 198
DpnII GATC 2 cut(s) 169, 196
DraI TTTAAA 1 cut(s) 27
FaeI CATG 2 cut(s) 24, 231
FaiI YATR 5 cut(s) 22, 87, 178, 229, 244
FatI CATG 2 cut(s) 20, 227
FbaI TGATCA 1 cut(s) 169
Hin1II CATG 2 cut(s) 24, 231
HincII GTYRAC 1 cut(s) 208
HindII GTYRAC 1 cut(s) 208
HinfI GANTC 2 cut(s) 118, 164
HpaI GTTAAC 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 3 cut(s) 57, 101, 110
Hpy8I GTNNAC 1 cut(s) 208
HpyCH4III ACNGT 1 cut(s) 34
HpyCH4IV ACGT 1 cut(s) 233
HpySE526I ACGT 1 cut(s) 233
Hsp92II CATG 2 cut(s) 24, 231
Ksp22I TGATCA 1 cut(s) 169
KspAI GTTAAC 1 cut(s) 208
Kzo9I GATC 2 cut(s) 169, 196
LpnPI CCDG 1 cut(s) 216
LweI GCATC 1 cut(s) 50
MaeII ACGT 1 cut(s) 233
MalI GATC 2 cut(s) 171, 198
MboI GATC 2 cut(s) 169, 196
MboII GAAGA 1 cut(s) 168
MluCI AATT 1 cut(s) 126
MnlI CCTC 3 cut(s) 53, 187, 210
MroXI GAANNNNTTC 1 cut(s) 117
MseI TTAA 5 cut(s) 9, 26, 77, 207, 250
MslI CAYNNNNRTG 1 cut(s) 232
NdeII GATC 2 cut(s) 169, 196
NlaIII CATG 2 cut(s) 24, 231
NspI RCATGY 2 cut(s) 24, 231
PciI ACATGT 2 cut(s) 20, 227
PdmI GAANNNNTTC 1 cut(s) 117
PfeI GAWTC 2 cut(s) 118, 164
Ppu21I YACGTR 1 cut(s) 234
PscI ACATGT 2 cut(s) 20, 227
RsaI GTAC 2 cut(s) 133, 232
RsaNI GTAC 2 cut(s) 132, 231
RseI CAYNNNNRTG 1 cut(s) 232
SaqAI TTAA 5 cut(s) 9, 26, 77, 207, 250
Sau3AI GATC 2 cut(s) 169, 196
SetI ASST 3 cut(s) 52, 221, 236
SfaNI GCATC 1 cut(s) 50
SgeI CNNG 7 cut(s) 33, 69, 113, 122, 215, 240, 246
SmiMI CAYNNNNRTG 1 cut(s) 232
Sse9I AATT 1 cut(s) 126
SspI AATATT 1 cut(s) 75
TaaI ACNGT 1 cut(s) 34
TaiI ACGT 1 cut(s) 236
TaqI TCGA 1 cut(s) 56
TasI AATT 1 cut(s) 126
TatI WGTACW 1 cut(s) 131
TfiI GAWTC 2 cut(s) 118, 164
Tru1I TTAA 5 cut(s) 9, 26, 77, 207, 250
Tru9I TTAA 5 cut(s) 9, 26, 77, 207, 250
TscAI CASTG 1 cut(s) 39
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 39
XapI RAATTY 1 cut(s) 126
XceI RCATGY 2 cut(s) 24, 231
XmnI GAANNNNTTC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.