RchiOBHm_Chr4g0402141

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
20681532 .. 20683134
1603 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37396

Sequence Viewer

Length: 381 bp
ATGTCTTGTTGTTATGATACTCTGCACCTGTGGCTTGGCAAATTAGATTACTTACCGGAGCTATGCAGAATCTGCACCGTCTTATATCTCGTCTTTCCTCGGGTCTGTGAGAAGCTTGCAGCTCAGTTGCACCACCAAGTTGAGAATAAGAGAGCTGAGGTCGAACCCAAGAAGATCTCGGAGTATCAGATTATTGAGATTACGGAGAATGTTTGTAATCTGAAGAAGGCGGAGGTGGATTGGATTTTGCTGATTGACATAGTTGAACAAGGAGATAAGTTGCAGCACGGAGGACTGGAGGAGCAGCTGCATGGCAGCATGGAACTGATGGAAGTTTGGTTGTTCACTTGTTGTCTTGTCGAACATTGTTTTCGTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.81

Weight (kDa)

5.16

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024979)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0402141 RchiOBHm_Chr5g0016971
rosa_multiflora Rmu_sc0004941.1_g000059

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 230
AcuI CTGAAG 1 cut(s) 242
AgsI TTSAA 1 cut(s) 266
AluBI AGCT 5 cut(s) 61, 115, 122, 155, 307
AluI AGCT 5 cut(s) 61, 115, 122, 155, 307
AlwNI CAGNNNCTG 1 cut(s) 72
Ama87I CYCGRG 1 cut(s) 99
ApeKI GCWGC 5 cut(s) 119, 283, 304, 307, 315
AvaI CYCGRG 1 cut(s) 99
BbvCI CCTCAGC 1 cut(s) 156
BbvI GCAGC 5 cut(s) 131, 294, 295, 316, 327
BccI CCATC 1 cut(s) 322
BglII AGATCT 1 cut(s) 174
BisI GCNGC 5 cut(s) 120, 284, 305, 308, 316
BlsI GCNGC 5 cut(s) 121, 285, 306, 309, 317
BmeT110I CYCGRG 1 cut(s) 99
BpmI CTGGAG 1 cut(s) 317
Bpu10I CCTNAGC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 98
BsaWI WCCGGW 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 300
BseDI CCNNGG 1 cut(s) 98
BseMII CTCAG 2 cut(s) 137, 147
BseNI ACTGG 1 cut(s) 300
BseRI GAGGAG 1 cut(s) 314
BseXI GCAGC 5 cut(s) 131, 294, 295, 316, 327
BsgI GTGCAG 2 cut(s) 8, 58
BsiHKCI CYCGRG 1 cut(s) 99
BsiSI CCGG 1 cut(s) 56
BsoBI CYCGRG 1 cut(s) 99
Bsp143I GATC 1 cut(s) 174
BspACI CCGC 1 cut(s) 230
BspCNI CTCAG 2 cut(s) 136, 148
BsrI ACTGG 1 cut(s) 300
BssECI CCNNGG 1 cut(s) 98
BssMI GATC 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 79
BstAPI GCANNNNNTGC 1 cut(s) 72
BstC8I GCNNGC 1 cut(s) 117
BstDEI CTNAG 2 cut(s) 123, 156
BstKTI GATC 1 cut(s) 177
BstMBI GATC 1 cut(s) 174
BstMWI GCNNNNNNNGC 2 cut(s) 31, 72
BstV1I GCAGC 5 cut(s) 131, 294, 295, 316, 327
BstX2I RGATCY 1 cut(s) 174
BstYI RGATCY 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 117
CaiI CAGNNNCTG 1 cut(s) 72
CviAII CATG 2 cut(s) 311, 319
CviJI RGCY 6 cut(s) 34, 61, 115, 122, 155, 307
CviKI_1 RGCY 6 cut(s) 34, 61, 115, 122, 155, 307
DdeI CTNAG 2 cut(s) 123, 156
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
EciI GGCGGA 1 cut(s) 245
Eco57I CTGAAG 1 cut(s) 242
Eco88I CYCGRG 1 cut(s) 99
FaeI CATG 2 cut(s) 314, 322
FaiI YATR 6 cut(s) 15, 64, 85, 260, 312, 320
FatI CATG 2 cut(s) 310, 318
Fnu4HI GCNGC 5 cut(s) 120, 284, 305, 308, 316
Fsp4HI GCNGC 5 cut(s) 120, 284, 305, 308, 316
GluI GCNGC 5 cut(s) 120, 284, 305, 308, 316
GsuI CTGGAG 1 cut(s) 317
HapII CCGG 1 cut(s) 56
Hin1II CATG 2 cut(s) 314, 322
HindIII AAGCTT 1 cut(s) 113
HinfI GANTC 1 cut(s) 69
HpaII CCGG 1 cut(s) 56
Hpy166II GTNNAC 1 cut(s) 345
Hpy188I TCNGA 3 cut(s) 181, 189, 222
Hpy8I GTNNAC 1 cut(s) 345
HpyAV CCTTC 1 cut(s) 220
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4V TGCA 7 cut(s) 25, 66, 75, 119, 130, 283, 310
HpyF10VI GCNNNNNNNGC 2 cut(s) 31, 72
HpyF3I CTNAG 2 cut(s) 123, 156
Hsp92II CATG 2 cut(s) 314, 322
Kzo9I GATC 1 cut(s) 174
LmnI GCTCC 2 cut(s) 58, 301
LpnPI CCDG 3 cut(s) 41, 69, 281
Lsp1109I GCAGC 5 cut(s) 131, 294, 295, 316, 327
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MboII GAAGA 2 cut(s) 184, 235
MflI RGATCY 1 cut(s) 174
MluCI AATT 1 cut(s) 41
MnlI CCTC 5 cut(s) 108, 151, 226, 284, 292
MseI TTAA 1 cut(s) 379
MspA1I CMGCKG 1 cut(s) 307
MspI CCGG 1 cut(s) 56
MwoI GCNNNNNNNGC 2 cut(s) 31, 72
NdeII GATC 1 cut(s) 174
NlaIII CATG 2 cut(s) 314, 322
PfeI GAWTC 1 cut(s) 69
PkrI GCNGC 5 cut(s) 121, 285, 306, 309, 317
PstNI CAGNNNCTG 1 cut(s) 72
PsuI RGATCY 1 cut(s) 174
PvuII CAGCTG 1 cut(s) 307
SaqAI TTAA 1 cut(s) 379
SatI GCNGC 5 cut(s) 120, 284, 305, 308, 316
Sau3AI GATC 1 cut(s) 174
SetI ASST 8 cut(s) 30, 63, 117, 124, 157, 162, 237, 309
Sse9I AATT 1 cut(s) 41
SsiI CCGC 1 cut(s) 230
TaaI ACNGT 1 cut(s) 79
TaqI TCGA 2 cut(s) 162, 360
TasI AATT 1 cut(s) 41
TfiI GAWTC 1 cut(s) 69
Tru1I TTAA 1 cut(s) 379
Tru9I TTAA 1 cut(s) 379
TseI GCWGC 5 cut(s) 119, 283, 304, 307, 315
TspGWI ACGGA 2 cut(s) 218, 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.