Rmu_sc0004941.1_g000059

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004941.1
OG0024979
Physical Location & Seq
Forward (+)
190577 .. 192717
2141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004941.1_g000059.1.cds

Sequence Viewer

Length: 678 bp
atgaccgaaagaccggaagggaccgatccggaccggccgtgtggcggtccggtcccggttcttgaaaataagtgtgttctggccggttcggttcctaagtgtccttggcggtccggtcaatcttcctcagctctcgcagactccgccagtccacctccaactctctcggtctctcgactctctcccagaaatcgatcttcctcaaccttcagtcagtcagccggtcagcccctctgttcctcacaatcggatactctgcacctgtggcttggcaaattagattacttaccggagctatgcagaatctgcaccgtcttatatctcgtctttcctcgggtctgtgagaagcttgcagctcagttgcaccaccaagttgagaataagagagctgaggtcgaacccaagaagatctcggagtatcagattattgagattacggagaatgtttgtaatctgaagaaggcggaggtggattggattttgctgattgacatagttgaacaaggagataagttgcagggaaaaaaatttgaagacggaggactggaggagcagctgcatggcagcatggaactgatggaagtttggccggtccccattctctgcatctgcaagtccggtccgaatttagctttgccggttccggtcccggtccctgtaaaagcagtgccggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

225

Amino Acids

24.64

Weight (kDa)

5.64

Isoelectric Point (pI)

66.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024979)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0402141 RchiOBHm_Chr5g0016971
rosa_multiflora Rmu_sc0004941.1_g000059

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 28
AciI CCGC 4 cut(s) 45, 109, 144, 464
AclWI GGATC 1 cut(s) 20
AcoI YGGCCR 3 cut(s) 35, 81, 587
AcsI RAATTY 2 cut(s) 527, 625
AcuI CTGAAG 2 cut(s) 193, 476
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 3 cut(s) 65, 500, 533
AluBI AGCT 7 cut(s) 131, 295, 349, 356, 389, 556, 632
AluI AGCT 7 cut(s) 131, 295, 349, 356, 389, 556, 632
Alw26I GTCTC 1 cut(s) 175
AlwI GGATC 1 cut(s) 20
AlwNI CAGNNNCTG 1 cut(s) 306
Ama87I CYCGRG 1 cut(s) 333
Aor13HI TCCGGA 1 cut(s) 28
AoxI GGCC 3 cut(s) 35, 81, 587
ApeKI GCWGC 4 cut(s) 353, 553, 556, 564
ApoI RAATTY 2 cut(s) 527, 625
AspS9I GGNCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
AsuC2I CCSGG 2 cut(s) 56, 650
AvaI CYCGRG 1 cut(s) 333
AvaII GGWCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
BbsI GAAGAC 1 cut(s) 540
BbvCI CCTCAGC 2 cut(s) 127, 390
BbvI GCAGC 4 cut(s) 365, 543, 565, 576
BccI CCATC 1 cut(s) 571
BceAI ACGGC 1 cut(s) 22
BciVI GTATCC 1 cut(s) 244
BcnI CCSGG 2 cut(s) 56, 650
BcoDI GTCTC 1 cut(s) 175
BfaI CTAG 1 cut(s) 676
BfuI GTATCC 1 cut(s) 244
BglII AGATCT 1 cut(s) 408
BisI GCNGC 4 cut(s) 354, 554, 557, 565
BlsI GCNGC 4 cut(s) 355, 555, 558, 566
Bme1390I CCNGG 2 cut(s) 56, 650
Bme18I GGWCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
BmeT110I CYCGRG 1 cut(s) 333
BmgT120I GGNCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
BmiI GGNNCC 7 cut(s) 22, 54, 93, 594, 642, 648, 654
BmrFI CCNGG 2 cut(s) 56, 650
BmsI GCATC 1 cut(s) 615
BpiI GAAGAC 1 cut(s) 540
BpmI CTGGAG 1 cut(s) 566
Bpu10I CCTNAGC 2 cut(s) 127, 390
BpuMI CCSGG 2 cut(s) 56, 650
Bsa29I ATCGAT 1 cut(s) 193
BsaI GGTCTC 1 cut(s) 175
BsaJI CCNNGG 2 cut(s) 104, 332
BsaWI WCCGGW 7 cut(s) 13, 28, 49, 113, 289, 617, 643
Bsc4I CCNNNNNNNGG 1 cut(s) 44
Bse118I RCCGGY 6 cut(s) 33, 83, 221, 589, 637, 670
Bse1I ACTGG 2 cut(s) 147, 549
BseAI TCCGGA 1 cut(s) 28
BseCI ATCGAT 1 cut(s) 193
BseDI CCNNGG 2 cut(s) 104, 332
BseLI CCNNNNNNNGG 1 cut(s) 44
BseMII CTCAG 3 cut(s) 141, 371, 381
BseNI ACTGG 2 cut(s) 147, 549
BseRI GAGGAG 1 cut(s) 563
BseX3I CGGCCG 1 cut(s) 35
BseXI GCAGC 4 cut(s) 365, 543, 565, 576
BsgI GTGCAG 2 cut(s) 242, 292
Bsh1285I CGRYCG 1 cut(s) 38
BshFI GGCC 3 cut(s) 37, 83, 589
BshVI ATCGAT 1 cut(s) 193
BsiEI CGRYCG 1 cut(s) 38
BsiHKCI CYCGRG 1 cut(s) 333
BslFI GGGAC 5 cut(s) 34, 38, 578, 632, 638
BslI CCNNNNNNNGG 1 cut(s) 44
BsmAI GTCTC 1 cut(s) 175
BsmFI GGGAC 5 cut(s) 34, 38, 578, 632, 638
BsnI GGCC 3 cut(s) 37, 83, 589
Bso31I GGTCTC 1 cut(s) 175
BsoBI CYCGRG 1 cut(s) 333
Bsp13I TCCGGA 1 cut(s) 28
Bsp143I GATC 3 cut(s) 25, 194, 408
BspACI CCGC 4 cut(s) 45, 109, 144, 464
BspANI GGCC 3 cut(s) 37, 83, 589
BspCNI CTCAG 3 cut(s) 140, 370, 382
BspDI ATCGAT 1 cut(s) 193
BspEI TCCGGA 1 cut(s) 28
BspLI GGNNCC 7 cut(s) 22, 54, 93, 594, 642, 648, 654
BspPI GGATC 1 cut(s) 20
BspTNI GGTCTC 1 cut(s) 175
BsrFI RCCGGY 6 cut(s) 33, 83, 221, 589, 637, 670
BsrI ACTGG 2 cut(s) 147, 549
BssAI RCCGGY 6 cut(s) 33, 83, 221, 589, 637, 670
BssECI CCNNGG 2 cut(s) 104, 332
BssMI GATC 3 cut(s) 25, 194, 408
BssT1I CCWWGG 1 cut(s) 104
Bst4CI ACNGT 1 cut(s) 313
BstAPI GCANNNNNTGC 1 cut(s) 306
BstC8I GCNNGC 1 cut(s) 351
BstDEI CTNAG 4 cut(s) 96, 127, 357, 390
BstKTI GATC 3 cut(s) 28, 197, 411
BstMAI GTCTC 1 cut(s) 175
BstMBI GATC 3 cut(s) 25, 194, 408
BstMCI CGRYCG 1 cut(s) 38
BstMWI GCNNNNNNNGC 3 cut(s) 143, 265, 306
BstSCI CCNGG 2 cut(s) 54, 648
BstV1I GCAGC 4 cut(s) 365, 543, 565, 576
BstV2I GAAGAC 1 cut(s) 540
BstX2I RGATCY 1 cut(s) 408
BstYI RGATCY 1 cut(s) 408
BstZI CGGCCG 1 cut(s) 35
Bsu15I ATCGAT 1 cut(s) 193
BsuI GTATCC 1 cut(s) 244
BsuRI GGCC 3 cut(s) 37, 83, 589
BsuTUI ATCGAT 1 cut(s) 193
BtsI GCAGTG 1 cut(s) 672
BtsIMutI CAGTG 1 cut(s) 672
Cac8I GCNNGC 1 cut(s) 351
CaiI CAGNNNCTG 1 cut(s) 306
Cfr10I RCCGGY 6 cut(s) 33, 83, 221, 589, 637, 670
Cfr13I GGNCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
ClaI ATCGAT 1 cut(s) 193
CpoI CGGWCCG 4 cut(s) 31, 47, 111, 620
CspI CGGWCCG 4 cut(s) 31, 47, 111, 620
CviAII CATG 2 cut(s) 560, 568
DdeI CTNAG 4 cut(s) 96, 127, 357, 390
DpnI GATC 3 cut(s) 27, 196, 410
DpnII GATC 3 cut(s) 25, 194, 408
EaeI YGGCCR 3 cut(s) 35, 81, 587
EagI CGGCCG 1 cut(s) 35
EciI GGCGGA 2 cut(s) 133, 479
EclXI CGGCCG 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 104
Eco31I GGTCTC 1 cut(s) 175
Eco47I GGWCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
Eco52I CGGCCG 1 cut(s) 35
Eco57I CTGAAG 2 cut(s) 193, 476
Eco88I CYCGRG 1 cut(s) 333
EcoT14I CCWWGG 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 104
FaeI CATG 2 cut(s) 563, 571
FaiI YATR 5 cut(s) 298, 319, 494, 561, 569
FaqI GGGAC 5 cut(s) 34, 38, 578, 632, 638
FatI CATG 2 cut(s) 559, 567
Fnu4HI GCNGC 4 cut(s) 354, 554, 557, 565
Fsp4HI GCNGC 4 cut(s) 354, 554, 557, 565
FspBI CTAG 1 cut(s) 676
GluI GCNGC 4 cut(s) 354, 554, 557, 565
GsuI CTGGAG 1 cut(s) 566
HaeIII GGCC 3 cut(s) 37, 83, 589
Hin1II CATG 2 cut(s) 563, 571
HindIII AAGCTT 1 cut(s) 347
HinfI GANTC 3 cut(s) 140, 177, 303
Hpy166II GTNNAC 1 cut(s) 152
Hpy188I TCNGA 5 cut(s) 250, 415, 423, 456, 624
Hpy188III TCNNGA 3 cut(s) 29, 62, 174
Hpy8I GTNNAC 1 cut(s) 152
HpyAV CCTTC 3 cut(s) 11, 217, 454
HpyCH4III ACNGT 1 cut(s) 313
HpyCH4V TGCA 9 cut(s) 259, 300, 309, 353, 364, 517, 559, 606, 612
HpyF10VI GCNNNNNNNGC 3 cut(s) 143, 265, 306
HpyF3I CTNAG 4 cut(s) 96, 127, 357, 390
Hsp92II CATG 2 cut(s) 563, 571
Kpn2I TCCGGA 1 cut(s) 28
Kzo9I GATC 3 cut(s) 25, 194, 408
LmnI GCTCC 2 cut(s) 292, 550
Lsp1109I GCAGC 4 cut(s) 365, 543, 565, 576
LweI GCATC 1 cut(s) 615
MaeI CTAG 1 cut(s) 676
MalI GATC 3 cut(s) 27, 196, 410
MboI GATC 3 cut(s) 25, 194, 408
MboII GAAGA 5 cut(s) 114, 189, 418, 469, 545
MflI RGATCY 1 cut(s) 408
MluCI AATT 3 cut(s) 275, 527, 625
MlyI GAGTC 2 cut(s) 134, 171
MmeI TCCRAC 1 cut(s) 182
MroI TCCGGA 1 cut(s) 28
MspA1I CMGCKG 1 cut(s) 556
MspR9I CCNGG 2 cut(s) 56, 650
MwoI GCNNNNNNNGC 3 cut(s) 143, 265, 306
NciI CCSGG 2 cut(s) 56, 650
NdeII GATC 3 cut(s) 25, 194, 408
NlaIII CATG 2 cut(s) 563, 571
NlaIV GGNNCC 7 cut(s) 22, 54, 93, 594, 642, 648, 654
PfeI GAWTC 1 cut(s) 303
PkrI GCNGC 4 cut(s) 355, 555, 558, 566
PleI GAGTC 2 cut(s) 134, 171
PpsI GAGTC 2 cut(s) 134, 171
PspN4I GGNNCC 7 cut(s) 22, 54, 93, 594, 642, 648, 654
PspPI GGNCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
PstNI CAGNNNCTG 1 cut(s) 306
PsuI RGATCY 1 cut(s) 408
PvuII CAGCTG 1 cut(s) 556
Rsr2I CGGWCCG 4 cut(s) 31, 47, 111, 620
RsrII CGGWCCG 4 cut(s) 31, 47, 111, 620
SatI GCNGC 4 cut(s) 354, 554, 557, 565
Sau3AI GATC 3 cut(s) 25, 194, 408
Sau96I GGNCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
SchI GAGTC 2 cut(s) 134, 171
ScrFI CCNGG 2 cut(s) 56, 650
SfaNI GCATC 1 cut(s) 615
SinI GGWCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
Sse9I AATT 3 cut(s) 275, 527, 625
SsiI CCGC 4 cut(s) 45, 109, 144, 464
SspMI CTAG 1 cut(s) 676
StyD4I CCNGG 2 cut(s) 54, 648
StyI CCWWGG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 313
TaqI TCGA 3 cut(s) 175, 193, 396
TaqII GACCGA 3 cut(s) 20, 38, 157
TasI AATT 3 cut(s) 275, 527, 625
TfiI GAWTC 1 cut(s) 303
TscAI CASTG 1 cut(s) 672
TseI GCWGC 4 cut(s) 353, 553, 556, 564
TspGWI ACGGA 2 cut(s) 452, 552
TspRI CASTG 1 cut(s) 672
VpaK11BI GGWCC 9 cut(s) 21, 31, 47, 52, 111, 592, 620, 646, 652
XapI RAATTY 2 cut(s) 527, 625
XspI CTAG 1 cut(s) 676
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.