RchiOBHm_Chr4g0406541

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
28369336 .. 28369895
560 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37788

Sequence Viewer

Length: 309 bp
ATGAGACAAATCAAAGGTTCAGAACCCCAAGTTTTAAACCCTCAGCTGGGATGTCTAGCAAACTTTTCTGCACCACAAAATGCTGTTTTACTGAATAACCAAATGCTCCACCACCGAACTTCCGATAATCACAACACATTCATTTGTGCTCACAAGGCATGTTGTTTGCTCCATCCACTCCATAAAGGCCAAGAAATCCAAGCCCATGTCATGAAATTTGGTCACTTATCTGATACCTTCATCGAAAGACTTTTTGCTCCATTTTTATGTAATTCAAAATTACATTGTTTCTGCTACCCATGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.62

Weight (kDa)

8.49

Isoelectric Point (pI)

41.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022739)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0406541
rosa_samantha Rh4AG139200 Rh4BG136300 Rh4DG133600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 215
AfiI CCNNNNNNNGG 2 cut(s) 46, 47
AgsI TTSAA 1 cut(s) 276
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
Alw21I GWGCWC 1 cut(s) 151
AoxI GGCC 1 cut(s) 187
ApoI RAATTY 1 cut(s) 215
Bbv12I GWGCWC 1 cut(s) 151
BbvCI CCTCAGC 1 cut(s) 42
BccI CCATC 1 cut(s) 180
BfaI CTAG 1 cut(s) 56
Bpu10I CCTNAGC 1 cut(s) 42
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 47
BseGI GGATG 2 cut(s) 56, 172
BseLI CCNNNNNNNGG 2 cut(s) 46, 47
BseMII CTCAG 1 cut(s) 56
BseYI CCCAGC 1 cut(s) 46
BsgI GTGCAG 1 cut(s) 54
BshFI GGCC 1 cut(s) 189
BsiHKAI GWGCWC 1 cut(s) 151
BslI CCNNNNNNNGG 2 cut(s) 46, 47
BsnI GGCC 1 cut(s) 189
Bsp1286I GDGCHC 1 cut(s) 151
BspANI GGCC 1 cut(s) 189
BspCNI CTCAG 1 cut(s) 55
BspHI TCATGA 1 cut(s) 210
BstDEI CTNAG 1 cut(s) 42
BstF5I GGATG 2 cut(s) 56, 172
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNSI RCATGY 1 cut(s) 162
BsuRI GGCC 1 cut(s) 189
BtsCI GGATG 2 cut(s) 56, 172
CciI TCATGA 1 cut(s) 210
CviAII CATG 4 cut(s) 159, 206, 211, 300
CviJI RGCY 3 cut(s) 46, 189, 203
CviKI_1 RGCY 3 cut(s) 46, 189, 203
DdeI CTNAG 1 cut(s) 42
DraI TTTAAA 1 cut(s) 36
FaeI CATG 4 cut(s) 162, 209, 214, 303
FaiI YATR 6 cut(s) 160, 183, 207, 212, 268, 301
FatI CATG 4 cut(s) 158, 205, 210, 299
FokI GGATG 2 cut(s) 63, 159
FspBI CTAG 1 cut(s) 56
GsaI CCCAGC 1 cut(s) 50
HaeIII GGCC 1 cut(s) 189
Hin1II CATG 4 cut(s) 162, 209, 214, 303
Hpy188I TCNGA 3 cut(s) 22, 124, 232
Hpy188III TCNNGA 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 247
HpyCH4V TGCA 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 1 cut(s) 42
Hsp92II CATG 4 cut(s) 162, 209, 214, 303
LmnI GCTCC 3 cut(s) 111, 174, 262
LpnPI CCDG 1 cut(s) 32
MaeI CTAG 1 cut(s) 56
MaeIII GTNAC 1 cut(s) 221
MhlI GDGCHC 1 cut(s) 151
MluCI AATT 3 cut(s) 215, 271, 278
MnlI CCTC 1 cut(s) 51
MseI TTAA 1 cut(s) 35
MslI CAYNNNNRTG 1 cut(s) 265
MspA1I CMGCKG 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 155
NlaIII CATG 4 cut(s) 162, 209, 214, 303
NmuCI GTSAC 1 cut(s) 221
NspI RCATGY 1 cut(s) 162
PagI TCATGA 1 cut(s) 210
PspFI CCCAGC 1 cut(s) 46
PvuII CAGCTG 1 cut(s) 46
RseI CAYNNNNRTG 1 cut(s) 265
SaqAI TTAA 1 cut(s) 35
SduI GDGCHC 1 cut(s) 151
SetI ASST 3 cut(s) 19, 48, 239
SgeI CNNG 9 cut(s) 41, 59, 68, 166, 171, 203, 212, 218, 223
SmiMI CAYNNNNRTG 1 cut(s) 265
Sse9I AATT 3 cut(s) 215, 271, 278
SspMI CTAG 1 cut(s) 56
TaqI TCGA 1 cut(s) 243
TasI AATT 3 cut(s) 215, 271, 278
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TseFI GTSAC 1 cut(s) 221
Tsp45I GTSAC 1 cut(s) 221
TspDTI ATGAA 3 cut(s) 130, 227, 229
XapI RAATTY 1 cut(s) 215
XceI RCATGY 1 cut(s) 162
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.