Rh4BG136300

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
24242747 .. 24243070
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG136300.1

Sequence Viewer

Length: 324 bp
ATGCCAGCGAATAGTCATTGTACCCAGCCTGACACTTATACAATGAGACAAATCAAAGGTTCAGAACCCCAAGTTTTAAACCCTCGGCTGGGATATCTAGCAAACTTTTCTGCACCACAAAATGCTGTTTTACTGAATAACCAAATGCTCCACCACCGAACTTCCGATAATCACAACACATTCATTTGTGCTCACAAGACATATTGCTTGCTCCATCCACTCCATAAAGGCCAAGAAATCCAAGCCCATGTCATGAAATTTGGTCACTTATCTGATACCTTCATCCAAAGACTTTTTGCTCCATTTTTATGTAATTCAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.23

Weight (kDa)

9.07

Isoelectric Point (pI)

34.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022739)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0406541
rosa_samantha Rh4AG139200 Rh4BG136300 Rh4DG133600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 257
AfaI GTAC 1 cut(s) 22
AfiI CCNNNNNNNGG 2 cut(s) 88, 89
AgsI TTSAA 1 cut(s) 318
Alw21I GWGCWC 1 cut(s) 193
Alw26I GTCTC 1 cut(s) 40
AoxI GGCC 1 cut(s) 229
ApoI RAATTY 1 cut(s) 257
Bbv12I GWGCWC 1 cut(s) 193
BccI CCATC 1 cut(s) 222
BcoDI GTCTC 1 cut(s) 40
BfaI CTAG 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 83
Bsc4I CCNNNNNNNGG 2 cut(s) 88, 89
BseDI CCNNGG 1 cut(s) 83
BseGI GGATG 2 cut(s) 214, 282
BseLI CCNNNNNNNGG 2 cut(s) 88, 89
BseYI CCCAGC 2 cut(s) 24, 88
BsgI GTGCAG 1 cut(s) 96
BshFI GGCC 1 cut(s) 231
BsiHKAI GWGCWC 1 cut(s) 193
BslI CCNNNNNNNGG 2 cut(s) 88, 89
BsmAI GTCTC 1 cut(s) 40
BsnI GGCC 1 cut(s) 231
Bsp1286I GDGCHC 1 cut(s) 193
BspANI GGCC 1 cut(s) 231
BspHI TCATGA 1 cut(s) 252
BssECI CCNNGG 1 cut(s) 83
BstC8I GCNNGC 2 cut(s) 6, 209
BstF5I GGATG 2 cut(s) 214, 282
BstMAI GTCTC 1 cut(s) 40
BsuRI GGCC 1 cut(s) 231
BtsCI GGATG 2 cut(s) 214, 282
Cac8I GCNNGC 2 cut(s) 6, 209
CciI TCATGA 1 cut(s) 252
Csp6I GTAC 1 cut(s) 21
CviAII CATG 2 cut(s) 248, 253
CviJI RGCY 4 cut(s) 28, 88, 231, 245
CviKI_1 RGCY 4 cut(s) 28, 88, 231, 245
CviQI GTAC 1 cut(s) 21
DraI TTTAAA 1 cut(s) 78
Eco32I GATATC 1 cut(s) 95
EcoRV GATATC 1 cut(s) 95
FaeI CATG 2 cut(s) 251, 256
FaiI YATR 6 cut(s) 39, 202, 225, 249, 254, 310
FatI CATG 2 cut(s) 247, 252
FokI GGATG 2 cut(s) 201, 269
FspBI CTAG 1 cut(s) 98
GsaI CCCAGC 2 cut(s) 28, 92
HaeIII GGCC 1 cut(s) 231
Hin1II CATG 2 cut(s) 251, 256
Hpy188I TCNGA 3 cut(s) 64, 166, 274
Hpy188III TCNNGA 1 cut(s) 253
HpyAV CCTTC 1 cut(s) 289
HpyCH4V TGCA 1 cut(s) 113
Hsp92II CATG 2 cut(s) 251, 256
LmnI GCTCC 3 cut(s) 153, 216, 304
LpnPI CCDG 4 cut(s) 18, 38, 42, 74
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 263
MhlI GDGCHC 1 cut(s) 193
MluCI AATT 2 cut(s) 257, 313
MnlI CCTC 1 cut(s) 93
MseI TTAA 1 cut(s) 77
MslI CAYNNNNRTG 1 cut(s) 307
NlaIII CATG 2 cut(s) 251, 256
NmeAIII GCCGAG 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 263
PagI TCATGA 1 cut(s) 252
PspFI CCCAGC 2 cut(s) 24, 88
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
RseI CAYNNNNRTG 1 cut(s) 307
SaqAI TTAA 1 cut(s) 77
SduI GDGCHC 1 cut(s) 193
SetI ASST 2 cut(s) 61, 281
SmiMI CAYNNNNRTG 1 cut(s) 307
Sse9I AATT 2 cut(s) 257, 313
SspMI CTAG 1 cut(s) 98
TasI AATT 2 cut(s) 257, 313
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TseFI GTSAC 1 cut(s) 263
Tsp45I GTSAC 1 cut(s) 263
TspDTI ATGAA 3 cut(s) 172, 269, 271
XapI RAATTY 1 cut(s) 257
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.