RchiOBHm_Chr4g0408461

Belongs to the universal ribosomal protein uS8 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0030070
Physical Location & Seq
Forward (+)
31199837 .. 31201567
1731 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37958

Sequence Viewer

Length: 552 bp
ATGATTCCGTTTGTTGTTGGTTTTGAGTTTGGGTTTGTATGCTGCATATTCACAATTCAAACAAACAGAGGTGAAATTTTCGGAGAATCGGAGGCGCCTCTGATTAGCTTGCTCATCTCCTTCGCAGCGACAATGGTGAGAGTTAGCGTGCTGAATGATGCTCTCAAGAGCATGTACAATGCAGAGAAACGTGGTAAGCGTCAGGTGATGATCAGGCCGTCATCCAAAGTGATCATCAAGTTTCTTATTGTCATGCAAAAGCATGGATACATTGGAGAGTTCGAGTATGTTGACGACCACAGGTCTGGTAAAATTGTGGTCGAACTGAATGGAAGGCTTAACAAGTGTGGGGTCATTAGTCCTCGTTTTGATGTTGGTGTTAAGGAGATTGAAGGTTGGACTGCCAGGTTGCTTCCTTCAAGACAGTTTGGATATATCATGCTCACCACTTCTGCTGGCATCATGGACCATGAAGTGGCTAGAAGAAAGAATGTTATTTCTTCGAGATGTTCCATATTATGTTTGTATGCTATTTATTTCTCCGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S8

Protein Analysis

183

Amino Acids

20.65

Weight (kDa)

9.22

Isoelectric Point (pI)

34.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 51 - 165 2.1e-15 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030070)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0408461 RchiOBHm_Chr5g0055271

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 94
AccB7I CCANNNNNTGG 1 cut(s) 475
AcsI RAATTY 1 cut(s) 75
AcyI GRCGYC 1 cut(s) 95
AfaI GTAC 1 cut(s) 176
AfiI CCNNNNNNNGG 1 cut(s) 475
AgsI TTSAA 3 cut(s) 59, 392, 420
AhdI GACNNNNNGTC 1 cut(s) 301
AjnI CCWGG 1 cut(s) 404
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
AoxI GGCC 1 cut(s) 215
ApeKI GCWGC 2 cut(s) 42, 125
ApoI RAATTY 1 cut(s) 75
AspLEI GCGC 1 cut(s) 97
AspS9I GGNCC 1 cut(s) 466
AsuHPI GGTGA 4 cut(s) 83, 148, 217, 436
AvaII GGWCC 1 cut(s) 466
BanI GGYRCC 1 cut(s) 94
BbvI GCAGC 2 cut(s) 29, 137
BceAI ACGGC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 406
BciVI GTATCC 1 cut(s) 260
BclI TGATCA 2 cut(s) 210, 231
BfaI CTAG 1 cut(s) 480
BfoI RGCGCY 1 cut(s) 98
BfuI GTATCC 1 cut(s) 260
BisI GCNGC 2 cut(s) 43, 126
BlsI GCNGC 2 cut(s) 44, 127
Bme1390I CCNGG 1 cut(s) 406
Bme18I GGWCC 1 cut(s) 466
BmeRI GACNNNNNGTC 1 cut(s) 301
BmgT120I GGNCC 1 cut(s) 466
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 406
BmsI GCATC 2 cut(s) 148, 468
BpuEI CTTGAG 1 cut(s) 149
BsaHI GRCGYC 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 475
BseBI CCWGG 1 cut(s) 406
BseGI GGATG 1 cut(s) 221
BseLI CCNNNNNNNGG 1 cut(s) 475
BseXI GCAGC 2 cut(s) 29, 137
BshFI GGCC 1 cut(s) 217
BshNI GGYRCC 1 cut(s) 94
BslI CCNNNNNNNGG 1 cut(s) 475
BsnI GGCC 1 cut(s) 217
Bsp1407I TGTACA 1 cut(s) 174
Bsp143I GATC 2 cut(s) 210, 231
BspANI GGCC 1 cut(s) 217
BspLI GGNNCC 1 cut(s) 96
BspT107I GGYRCC 1 cut(s) 94
BsrGI TGTACA 1 cut(s) 174
BssMI GATC 2 cut(s) 210, 231
BssNI GRCGYC 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 406
Bst4CI ACNGT 1 cut(s) 426
BstACI GRCGYC 1 cut(s) 95
BstAUI TGTACA 1 cut(s) 174
BstC8I GCNNGC 3 cut(s) 110, 149, 457
BstF5I GGATG 1 cut(s) 221
BstH2I RGCGCY 1 cut(s) 98
BstHHI GCGC 1 cut(s) 97
BstKTI GATC 2 cut(s) 213, 234
BstMBI GATC 2 cut(s) 210, 231
BstNI CCWGG 1 cut(s) 406
BstNSI RCATGY 1 cut(s) 175
BstSCI CCNGG 1 cut(s) 404
BstV1I GCAGC 2 cut(s) 29, 137
BstXI CCANNNNNNTGG 1 cut(s) 305
BsuI GTATCC 1 cut(s) 260
BsuRI GGCC 1 cut(s) 217
BtsCI GGATG 1 cut(s) 221
Cac8I GCNNGC 3 cut(s) 110, 149, 457
CfoI GCGC 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 466
CseI GACGC 1 cut(s) 188
Csp6I GTAC 1 cut(s) 175
CviAII CATG 6 cut(s) 172, 253, 263, 439, 463, 470
CviJI RGCY 4 cut(s) 108, 217, 337, 479
CviKI_1 RGCY 4 cut(s) 108, 217, 337, 479
CviQI GTAC 1 cut(s) 175
DinI GGCGCC 1 cut(s) 96
DpnI GATC 2 cut(s) 212, 233
DpnII GATC 2 cut(s) 210, 231
DriI GACNNNNNGTC 1 cut(s) 301
Eam1105I GACNNNNNGTC 1 cut(s) 301
Eco47I GGWCC 1 cut(s) 466
EcoRII CCWGG 1 cut(s) 404
EgeI GGCGCC 1 cut(s) 96
EheI GGCGCC 1 cut(s) 96
FaeI CATG 6 cut(s) 175, 256, 266, 442, 466, 473
FatI CATG 6 cut(s) 171, 252, 262, 438, 462, 469
FbaI TGATCA 2 cut(s) 210, 231
Fnu4HI GCNGC 2 cut(s) 43, 126
FokI GGATG 1 cut(s) 208
Fsp4HI GCNGC 2 cut(s) 43, 126
FspBI CTAG 1 cut(s) 480
GlaI GCGC 1 cut(s) 96
GluI GCNGC 2 cut(s) 43, 126
HaeII RGCGCY 1 cut(s) 98
HaeIII GGCC 1 cut(s) 217
HgaI GACGC 1 cut(s) 188
HhaI GCGC 1 cut(s) 97
Hin1I GRCGYC 1 cut(s) 95
Hin1II CATG 6 cut(s) 175, 256, 266, 442, 466, 473
Hin6I GCGC 1 cut(s) 95
HinP1I GCGC 1 cut(s) 95
HincII GTYRAC 1 cut(s) 292
HindII GTYRAC 1 cut(s) 292
HinfI GANTC 2 cut(s) 4, 86
HphI GGTGA 4 cut(s) 83, 148, 217, 436
Hpy166II GTNNAC 1 cut(s) 292
Hpy188I TCNGA 3 cut(s) 83, 91, 102
Hpy188III TCNNGA 3 cut(s) 166, 420, 504
Hpy8I GTNNAC 1 cut(s) 292
HpyAV CCTTC 4 cut(s) 130, 327, 386, 426
HpyCH4III ACNGT 1 cut(s) 426
HpyCH4IV ACGT 1 cut(s) 190
HpyCH4V TGCA 3 cut(s) 45, 182, 256
HpySE526I ACGT 1 cut(s) 190
Hsp92I GRCGYC 1 cut(s) 95
Hsp92II CATG 6 cut(s) 175, 256, 266, 442, 466, 473
HspAI GCGC 1 cut(s) 95
KasI GGCGCC 1 cut(s) 94
Ksp22I TGATCA 2 cut(s) 210, 231
Kzo9I GATC 2 cut(s) 210, 231
LpnPI CCDG 7 cut(s) 188, 199, 286, 291, 391, 418, 441
Lsp1109I GCAGC 2 cut(s) 29, 137
LweI GCATC 2 cut(s) 148, 468
MaeI CTAG 1 cut(s) 480
MaeII ACGT 1 cut(s) 190
MalI GATC 2 cut(s) 212, 233
MboI GATC 2 cut(s) 210, 231
MboII GAAGA 2 cut(s) 492, 495
MluCI AATT 3 cut(s) 54, 75, 312
Mly113I GGCGCC 1 cut(s) 95
MmeI TCCRAC 1 cut(s) 377
MnlI CCTC 4 cut(s) 62, 85, 108, 372
MseI TTAA 2 cut(s) 339, 381
MspR9I CCNGG 1 cut(s) 406
MvaI CCWGG 1 cut(s) 406
NarI GGCGCC 1 cut(s) 95
NdeII GATC 2 cut(s) 210, 231
NlaIII CATG 6 cut(s) 175, 256, 266, 442, 466, 473
NlaIV GGNNCC 1 cut(s) 96
NspI RCATGY 1 cut(s) 175
PcsI WCGNNNNNNNCGW 1 cut(s) 196
PfeI GAWTC 2 cut(s) 4, 86
PflMI CCANNNNNTGG 1 cut(s) 475
PkrI GCNGC 2 cut(s) 44, 127
PluTI GGCGCC 1 cut(s) 98
Psp6I CCWGG 1 cut(s) 404
PspGI CCWGG 1 cut(s) 404
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 466
RsaI GTAC 1 cut(s) 176
RsaNI GTAC 1 cut(s) 175
SaqAI TTAA 2 cut(s) 339, 381
SatI GCNGC 2 cut(s) 43, 126
Sau3AI GATC 2 cut(s) 210, 231
Sau96I GGNCC 1 cut(s) 466
ScrFI CCNGG 1 cut(s) 406
SetI ASST 7 cut(s) 73, 110, 193, 207, 305, 397, 410
SfaNI GCATC 2 cut(s) 148, 468
SfoI GGCGCC 1 cut(s) 96
SinI GGWCC 1 cut(s) 466
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 3 cut(s) 54, 75, 312
SspDI GGCGCC 1 cut(s) 94
SspMI CTAG 1 cut(s) 480
StyD4I CCNGG 1 cut(s) 404
TaaI ACNGT 1 cut(s) 426
TaiI ACGT 1 cut(s) 193
TaqI TCGA 3 cut(s) 282, 321, 503
TasI AATT 3 cut(s) 54, 75, 312
TatI WGTACW 1 cut(s) 174
TfiI GAWTC 2 cut(s) 4, 86
Tru1I TTAA 2 cut(s) 339, 381
Tru9I TTAA 2 cut(s) 339, 381
TseI GCWGC 2 cut(s) 42, 125
TspDTI ATGAA 1 cut(s) 486
TspGWI ACGGA 1 cut(s) 532
Van91I CCANNNNNTGG 1 cut(s) 475
VpaK11BI GGWCC 1 cut(s) 466
XapI RAATTY 1 cut(s) 75
XceI RCATGY 1 cut(s) 175
XspI CTAG 1 cut(s) 480
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.