RchiOBHm_Chr5g0055271

Belongs to the universal ribosomal protein uS8 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
58186579 .. 58191066
4488 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33230

Sequence Viewer

Length: 480 bp
ATGATTCCGTTTGTTGTTGGTTTTGAGTTTGGGTTTGTATGCTGCATATTCACAATTCAAACAAACAGAGGTGAAATTTTCGGAGAATCGGAGGCGCCTCTAATTAGCTTGCTCATCTCTTTCGCAGCGACAATGGTGAGAGTTAGCGTGCTGAATGATGCTCTCAAGAGCATGTACAATGCAGAGAAACGTGGATACATTGGAGAGTTCGAGTATGTTGACGACCACAGGTCTGGTAAAATTGTGGTCGAACTGAATGGAAGGCTTAACAAGTGTGGGGTCATTAGTCCTCGTTTTGATGTTGGTGTTAAGGAGATTGAAGGTTGGACTGCCAGGTTGCTTCCTTCAAGACAGTTTGGATATATCGTGCTCACCACTTCTGCTGGCATCATGGACCATGAAGTGGCTAGAAGAAAGAACGTTATTTCTTCGAGATGTTCCATATTATGTTTGTATGCTATTTATTTCTCCGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

159

Amino Acids

17.79

Weight (kDa)

7.58

Isoelectric Point (pI)

33.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 62 - 141 5.5e-06 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030070)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0408461 RchiOBHm_Chr5g0055271

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 94
AccB7I CCANNNNNTGG 1 cut(s) 403
AclI AACGTT 1 cut(s) 420
AcsI RAATTY 1 cut(s) 75
AcyI GRCGYC 1 cut(s) 95
AfaI GTAC 1 cut(s) 176
AfiI CCNNNNNNNGG 1 cut(s) 403
AgsI TTSAA 3 cut(s) 59, 320, 348
AhdI GACNNNNNGTC 1 cut(s) 229
AjnI CCWGG 1 cut(s) 332
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
Alw21I GWGCWC 1 cut(s) 372
ApeKI GCWGC 2 cut(s) 42, 125
ApoI RAATTY 1 cut(s) 75
AspLEI GCGC 1 cut(s) 97
AspS9I GGNCC 1 cut(s) 394
AsuHPI GGTGA 3 cut(s) 83, 148, 364
AvaII GGWCC 1 cut(s) 394
BanI GGYRCC 1 cut(s) 94
Bbv12I GWGCWC 1 cut(s) 372
BbvI GCAGC 2 cut(s) 29, 137
BciT130I CCWGG 1 cut(s) 334
BciVI GTATCC 1 cut(s) 188
BfaI CTAG 1 cut(s) 408
BfoI RGCGCY 1 cut(s) 98
BfuI GTATCC 1 cut(s) 188
BisI GCNGC 2 cut(s) 43, 126
BlsI GCNGC 2 cut(s) 44, 127
Bme1390I CCNGG 1 cut(s) 334
Bme18I GGWCC 1 cut(s) 394
BmeRI GACNNNNNGTC 1 cut(s) 229
BmgT120I GGNCC 1 cut(s) 394
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 334
BmsI GCATC 2 cut(s) 148, 396
BpuEI CTTGAG 1 cut(s) 149
BsaHI GRCGYC 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 403
BseBI CCWGG 1 cut(s) 334
BseLI CCNNNNNNNGG 1 cut(s) 403
BseXI GCAGC 2 cut(s) 29, 137
BshNI GGYRCC 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 372
BslI CCNNNNNNNGG 1 cut(s) 403
Bsp1286I GDGCHC 1 cut(s) 372
Bsp1407I TGTACA 1 cut(s) 174
BspLI GGNNCC 1 cut(s) 96
BspT107I GGYRCC 1 cut(s) 94
BsrGI TGTACA 1 cut(s) 174
BssNI GRCGYC 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 334
Bst4CI ACNGT 1 cut(s) 354
BstACI GRCGYC 1 cut(s) 95
BstAUI TGTACA 1 cut(s) 174
BstC8I GCNNGC 3 cut(s) 110, 149, 385
BstH2I RGCGCY 1 cut(s) 98
BstHHI GCGC 1 cut(s) 97
BstNI CCWGG 1 cut(s) 334
BstNSI RCATGY 1 cut(s) 175
BstSCI CCNGG 1 cut(s) 332
BstV1I GCAGC 2 cut(s) 29, 137
BstXI CCANNNNNNTGG 1 cut(s) 233
BsuI GTATCC 1 cut(s) 188
Cac8I GCNNGC 3 cut(s) 110, 149, 385
CfoI GCGC 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 394
Csp6I GTAC 1 cut(s) 175
CviAII CATG 3 cut(s) 172, 391, 398
CviJI RGCY 3 cut(s) 108, 265, 407
CviKI_1 RGCY 3 cut(s) 108, 265, 407
CviQI GTAC 1 cut(s) 175
DinI GGCGCC 1 cut(s) 96
DriI GACNNNNNGTC 1 cut(s) 229
Eam1105I GACNNNNNGTC 1 cut(s) 229
Eco47I GGWCC 1 cut(s) 394
EcoRII CCWGG 1 cut(s) 332
EgeI GGCGCC 1 cut(s) 96
EheI GGCGCC 1 cut(s) 96
FaeI CATG 3 cut(s) 175, 394, 401
FatI CATG 3 cut(s) 171, 390, 397
Fnu4HI GCNGC 2 cut(s) 43, 126
Fsp4HI GCNGC 2 cut(s) 43, 126
FspBI CTAG 1 cut(s) 408
GlaI GCGC 1 cut(s) 96
GluI GCNGC 2 cut(s) 43, 126
HaeII RGCGCY 1 cut(s) 98
HhaI GCGC 1 cut(s) 97
Hin1I GRCGYC 1 cut(s) 95
Hin1II CATG 3 cut(s) 175, 394, 401
Hin6I GCGC 1 cut(s) 95
HinP1I GCGC 1 cut(s) 95
HincII GTYRAC 1 cut(s) 220
HindII GTYRAC 1 cut(s) 220
HinfI GANTC 2 cut(s) 4, 86
HphI GGTGA 3 cut(s) 83, 148, 364
Hpy166II GTNNAC 1 cut(s) 220
Hpy188I TCNGA 2 cut(s) 83, 91
Hpy188III TCNNGA 3 cut(s) 166, 348, 432
Hpy8I GTNNAC 1 cut(s) 220
HpyAV CCTTC 3 cut(s) 255, 314, 354
HpyCH4III ACNGT 1 cut(s) 354
HpyCH4IV ACGT 2 cut(s) 190, 420
HpyCH4V TGCA 2 cut(s) 45, 182
HpySE526I ACGT 2 cut(s) 190, 420
Hsp92I GRCGYC 1 cut(s) 95
Hsp92II CATG 3 cut(s) 175, 394, 401
HspAI GCGC 1 cut(s) 95
KasI GGCGCC 1 cut(s) 94
LpnPI CCDG 5 cut(s) 214, 219, 319, 346, 369
Lsp1109I GCAGC 2 cut(s) 29, 137
LweI GCATC 2 cut(s) 148, 396
MaeI CTAG 1 cut(s) 408
MaeII ACGT 2 cut(s) 190, 420
MboII GAAGA 2 cut(s) 420, 423
MhlI GDGCHC 1 cut(s) 372
MluCI AATT 4 cut(s) 54, 75, 102, 240
Mly113I GGCGCC 1 cut(s) 95
MmeI TCCRAC 1 cut(s) 305
MnlI CCTC 4 cut(s) 62, 85, 108, 300
MseI TTAA 2 cut(s) 267, 309
MspR9I CCNGG 1 cut(s) 334
MvaI CCWGG 1 cut(s) 334
NarI GGCGCC 1 cut(s) 95
NlaIII CATG 3 cut(s) 175, 394, 401
NlaIV GGNNCC 1 cut(s) 96
NspI RCATGY 1 cut(s) 175
PfeI GAWTC 2 cut(s) 4, 86
PflMI CCANNNNNTGG 1 cut(s) 403
PkrI GCNGC 2 cut(s) 44, 127
PluTI GGCGCC 1 cut(s) 98
Psp1406I AACGTT 1 cut(s) 420
Psp6I CCWGG 1 cut(s) 332
PspGI CCWGG 1 cut(s) 332
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 394
RsaI GTAC 1 cut(s) 176
RsaNI GTAC 1 cut(s) 175
SaqAI TTAA 2 cut(s) 267, 309
SatI GCNGC 2 cut(s) 43, 126
Sau96I GGNCC 1 cut(s) 394
ScrFI CCNGG 1 cut(s) 334
SduI GDGCHC 1 cut(s) 372
SetI ASST 7 cut(s) 73, 110, 193, 233, 325, 338, 423
SfaNI GCATC 2 cut(s) 148, 396
SfoI GGCGCC 1 cut(s) 96
SinI GGWCC 1 cut(s) 394
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 4 cut(s) 54, 75, 102, 240
SspDI GGCGCC 1 cut(s) 94
SspMI CTAG 1 cut(s) 408
StyD4I CCNGG 1 cut(s) 332
TaaI ACNGT 1 cut(s) 354
TaiI ACGT 2 cut(s) 193, 423
TaqI TCGA 3 cut(s) 210, 249, 431
TasI AATT 4 cut(s) 54, 75, 102, 240
TatI WGTACW 1 cut(s) 174
TfiI GAWTC 2 cut(s) 4, 86
Tru1I TTAA 2 cut(s) 267, 309
Tru9I TTAA 2 cut(s) 267, 309
TseI GCWGC 2 cut(s) 42, 125
TspDTI ATGAA 1 cut(s) 414
TspGWI ACGGA 1 cut(s) 460
Van91I CCANNNNNTGG 1 cut(s) 403
VpaK11BI GGWCC 1 cut(s) 394
XapI RAATTY 1 cut(s) 75
XceI RCATGY 1 cut(s) 175
XspI CTAG 1 cut(s) 408
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.