Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0030085

Physical Location & Seq

Genomic Coordinates Reverse (-)

39054759 .. 39057899

Gene Structure 3141 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ38493

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGGGTATGGCAATATCTAGGATGGTGAAGATGCTGTTTGCAAGGAAAGAAATGAGAACACTAATGGTGGGTCTTGATGCTGCTGGTAAAACCGCCATCCTCTACAAGCTTAAAGTTGCACAATTGACAATTGCAGAGTCTGTTGGCGATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04072 ko04144 ko05110 ko05134 map04072 map04144 map05110 map05134

Pfam Domains

Protein Families

Arf

Protein Analysis

50

Amino Acids

5.46

Weight (kDa)

9.99

Isoelectric Point (pI)

18.07

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Arf	PF00025	6 - 42	1.3e-09	ADP-ribosylation factor family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030085)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0414541
rosa_samantha	Rh4AG186500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	93
AluBI	AGCT	1 cut(s)	109
AluI	AGCT	1 cut(s)	109
AlwNI	CAGNNNCTG	1 cut(s)	140
ApeKI	GCWGC	1 cut(s)	80
AsuHPI	GGTGA	1 cut(s)	37
BbvI	GCAGC	1 cut(s)	67
BccI	CCATC	2 cut(s)	16, 104
BfaI	CTAG	1 cut(s)	18
BisI	GCNGC	1 cut(s)	81
BlsI	GCNGC	1 cut(s)	82
BmsI	GCATC	2 cut(s)	21, 67
BseGI	GGATG	2 cut(s)	27, 96
BseXI	GCAGC	1 cut(s)	67
BspACI	CCGC	1 cut(s)	93
BstF5I	GGATG	2 cut(s)	27, 96
BstV1I	GCAGC	1 cut(s)	67
BtsCI	GGATG	2 cut(s)	27, 96
CaiI	CAGNNNCTG	1 cut(s)	140
CviJI	RGCY	1 cut(s)	109
CviKI_1	RGCY	1 cut(s)	109
FaiI	YATR	1 cut(s)	8
Fnu4HI	GCNGC	1 cut(s)	81
FokI	GGATG	2 cut(s)	34, 83
Fsp4HI	GCNGC	1 cut(s)	81
FspBI	CTAG	1 cut(s)	18
GluI	GCNGC	1 cut(s)	81
HindIII	AAGCTT	1 cut(s)	107
HinfI	GANTC	1 cut(s)	137
HphI	GGTGA	1 cut(s)	37
Hpy188III	TCNNGA	1 cut(s)	74
HpyCH4V	TGCA	3 cut(s)	41, 119, 134
LpnPI	CCDG	1 cut(s)	69
Lsp1109I	GCAGC	1 cut(s)	67
LweI	GCATC	2 cut(s)	21, 67
MaeI	CTAG	1 cut(s)	18
MboII	GAAGA	1 cut(s)	40
MfeI	CAATTG	2 cut(s)	122, 129
MluCI	AATT	2 cut(s)	122, 129
MlyI	GAGTC	1 cut(s)	146
MnlI	CCTC	1 cut(s)	110
MseI	TTAA	1 cut(s)	111
MunI	CAATTG	2 cut(s)	122, 129
PkrI	GCNGC	1 cut(s)	82
PleI	GAGTC	1 cut(s)	145
PpsI	GAGTC	1 cut(s)	145
PstNI	CAGNNNCTG	1 cut(s)	140
SaqAI	TTAA	1 cut(s)	111
SatI	GCNGC	1 cut(s)	81
SchI	GAGTC	1 cut(s)	146
SetI	ASST	1 cut(s)	111
SfaNI	GCATC	2 cut(s)	21, 67
SgeI	CNNG	5 cut(s)	30, 54, 86, 96, 118
Sse9I	AATT	2 cut(s)	122, 129
SsiI	CCGC	1 cut(s)	93
SspMI	CTAG	1 cut(s)	18
TasI	AATT	2 cut(s)	122, 129
Tru1I	TTAA	1 cut(s)	111
Tru9I	TTAA	1 cut(s)	111
TseI	GCWGC	1 cut(s)	80
XspI	CTAG	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.