Rh4AG186500
ERF Family

Belongs to the small GTPase superfamily. Arf family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0030085
Physical Location & Seq
Reverse (-)
46498927 .. 46499616
690 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG186500.1

Sequence Viewer

Length: 219 bp
ATGAAAATTCCTATCAAAGGAGAATACATCACCTTAATCTCATCGATTCACCTGATTTTCTATCCTGTTGAAAAAATGGGTATGGCAATATCTAGGATGGTGAAGATGCTGTTTGCAAGGAAAGAAATGAGAACACTAATGGTGGGTCTTGATGCTGCTGGTAAAACTGCCATCCTCTACAAGCTTAAAGTTGCACAATTGTTGTCGTCTATGACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04072 ko04144 ko05110 ko05134 map04072 map04144 map05110 map05134
Pfam Domains
Protein Families
Arf

Protein Analysis

72

Amino Acids

8.12

Weight (kDa)

10.07

Isoelectric Point (pI)

29.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 32 - 68 3.4e-09 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030085)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0414541
rosa_samantha Rh4AG186500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 1 cut(s) 184
AluI AGCT 1 cut(s) 184
ApeKI GCWGC 1 cut(s) 155
ApoI RAATTY 1 cut(s) 6
AsuHPI GGTGA 3 cut(s) 22, 41, 112
BbvI GCAGC 1 cut(s) 142
BccI CCATC 2 cut(s) 91, 179
BfaI CTAG 1 cut(s) 93
BisI GCNGC 1 cut(s) 156
BlsI GCNGC 1 cut(s) 157
BmsI GCATC 2 cut(s) 96, 142
Bsa29I ATCGAT 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 17
BseCI ATCGAT 1 cut(s) 44
BseGI GGATG 2 cut(s) 102, 171
BseLI CCNNNNNNNGG 1 cut(s) 17
BseXI GCAGC 1 cut(s) 142
BshVI ATCGAT 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 17
BspDI ATCGAT 1 cut(s) 44
BstENI CCTNNNNNAGG 1 cut(s) 15
BstF5I GGATG 2 cut(s) 102, 171
BstV1I GCAGC 1 cut(s) 142
Bsu15I ATCGAT 1 cut(s) 44
BsuTUI ATCGAT 1 cut(s) 44
BtsCI GGATG 2 cut(s) 102, 171
ClaI ATCGAT 1 cut(s) 44
CviJI RGCY 1 cut(s) 184
CviKI_1 RGCY 1 cut(s) 184
EcoNI CCTNNNNNAGG 1 cut(s) 15
FaiI YATR 2 cut(s) 83, 212
Fnu4HI GCNGC 1 cut(s) 156
FokI GGATG 2 cut(s) 109, 158
Fsp4HI GCNGC 1 cut(s) 156
FspBI CTAG 1 cut(s) 93
GluI GCNGC 1 cut(s) 156
HindIII AAGCTT 1 cut(s) 182
HinfI GANTC 1 cut(s) 46
HphI GGTGA 3 cut(s) 22, 41, 112
Hpy188III TCNNGA 1 cut(s) 149
HpyCH4V TGCA 2 cut(s) 116, 194
LpnPI CCDG 3 cut(s) 65, 78, 144
Lsp1109I GCAGC 1 cut(s) 142
LweI GCATC 2 cut(s) 96, 142
MaeI CTAG 1 cut(s) 93
MboII GAAGA 1 cut(s) 115
MfeI CAATTG 1 cut(s) 197
MluCI AATT 2 cut(s) 6, 197
MnlI CCTC 1 cut(s) 185
MseI TTAA 3 cut(s) 35, 186, 217
MunI CAATTG 1 cut(s) 197
PfeI GAWTC 1 cut(s) 46
PkrI GCNGC 1 cut(s) 157
SaqAI TTAA 3 cut(s) 35, 186, 217
SatI GCNGC 1 cut(s) 156
SetI ASST 3 cut(s) 35, 54, 186
SfaNI GCATC 2 cut(s) 96, 142
SgeI CNNG 7 cut(s) 64, 77, 105, 129, 161, 171, 193
Sse9I AATT 2 cut(s) 6, 197
SspMI CTAG 1 cut(s) 93
TaqI TCGA 1 cut(s) 44
TasI AATT 2 cut(s) 6, 197
TfiI GAWTC 1 cut(s) 46
Tru1I TTAA 3 cut(s) 35, 186, 217
Tru9I TTAA 3 cut(s) 35, 186, 217
TseI GCWGC 1 cut(s) 155
TspDTI ATGAA 1 cut(s) 17
XagI CCTNNNNNAGG 1 cut(s) 15
XapI RAATTY 1 cut(s) 6
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.