RchiOBHm_Chr4g0443301

At4g28440-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0021403
Physical Location & Seq
Reverse (-)
64492498 .. 64492743
246 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41101

Sequence Viewer

Length: 246 bp
ATGTATTGTGCAGTGGACTTGATGAAAGAGGGTTCGACTCTAACCCTGCGAAATGCCGAAATTTACATGTTCAAAGGAACAATGAGGCTTGCTGTGGGCGAAAGTGGCAGTGTTGAAGTGGCCGAGCCTGCCAGTTTTACCGTGGGGGAAGATAACCTCTCACTCCTTGATTTTAAACGTCCACTCCTTGGATTGATTAAATTTTTGGGAATTATGAGATGTCTTAGGGAAATGAAAGGTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03420 ko03430 ko03440 ko03460 map03030 map03420 map03430 map03440 map03460
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.98

Weight (kDa)

6.21

Isoelectric Point (pI)

27.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OB_Ssb-like PF21473 5 - 40 8e-12 Single-stranded DNA binding protein Ssb-like, OB fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021403)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0443301
rosa_multiflora Rmu_sc0021666.1_g000002 Rmu_ssc0000122.1_g000005
rosa_samantha Rh4CG427300 Rh4DG407300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 120
AcsI RAATTY 2 cut(s) 60, 200
AfiI CCNNNNNNNGG 1 cut(s) 188
AflIII ACRYGT 1 cut(s) 66
AgsI TTSAA 2 cut(s) 73, 116
AoxI GGCC 1 cut(s) 120
ApoI RAATTY 2 cut(s) 60, 200
BsaJI CCNNGG 2 cut(s) 141, 187
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 132
BseDI CCNNGG 2 cut(s) 141, 187
BseLI CCNNNNNNNGG 1 cut(s) 188
BseNI ACTGG 1 cut(s) 132
BsgI GTGCAG 1 cut(s) 30
BshFI GGCC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 188
BsnI GGCC 1 cut(s) 122
BspANI GGCC 1 cut(s) 122
BsrI ACTGG 1 cut(s) 132
BssECI CCNNGG 2 cut(s) 141, 187
BssT1I CCWWGG 1 cut(s) 187
Bst4CI ACNGT 1 cut(s) 142
BstC8I GCNNGC 2 cut(s) 90, 129
BstDEI CTNAG 1 cut(s) 224
BstDSI CCRYGG 1 cut(s) 141
BstMWI GCNNNNNNNGC 2 cut(s) 105, 128
BstNSI RCATGY 1 cut(s) 70
BsuRI GGCC 1 cut(s) 122
BtgI CCRYGG 1 cut(s) 141
BtsI GCAGTG 2 cut(s) 18, 115
BtsIMutI CAGTG 2 cut(s) 18, 115
Cac8I GCNNGC 2 cut(s) 90, 129
CviAII CATG 1 cut(s) 67
CviJI RGCY 3 cut(s) 88, 122, 127
CviKI_1 RGCY 3 cut(s) 88, 122, 127
DdeI CTNAG 1 cut(s) 224
DraI TTTAAA 1 cut(s) 175
EaeI YGGCCR 1 cut(s) 120
Eco130I CCWWGG 1 cut(s) 187
EcoT14I CCWWGG 1 cut(s) 187
ErhI CCWWGG 1 cut(s) 187
FaeI CATG 1 cut(s) 70
FaiI YATR 2 cut(s) 68, 215
FatI CATG 1 cut(s) 66
HaeIII GGCC 1 cut(s) 122
Hin1II CATG 1 cut(s) 70
HinfI GANTC 1 cut(s) 37
Hpy166II GTNNAC 2 cut(s) 16, 182
Hpy8I GTNNAC 2 cut(s) 16, 182
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4IV ACGT 1 cut(s) 178
HpyCH4V TGCA 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 2 cut(s) 105, 128
HpyF3I CTNAG 1 cut(s) 224
HpySE526I ACGT 1 cut(s) 178
Hsp92II CATG 1 cut(s) 70
LpnPI CCDG 3 cut(s) 59, 141, 145
MaeII ACGT 1 cut(s) 178
MboII GAAGA 1 cut(s) 161
MluCI AATT 3 cut(s) 60, 200, 210
MlyI GAGTC 1 cut(s) 31
MnlI CCTC 3 cut(s) 22, 78, 167
MseI TTAA 2 cut(s) 174, 198
MwoI GCNNNNNNNGC 2 cut(s) 105, 128
NlaIII CATG 1 cut(s) 70
NmeAIII GCCGAG 1 cut(s) 148
NspI RCATGY 1 cut(s) 70
PciI ACATGT 1 cut(s) 66
PflMI CCANNNNNTGG 1 cut(s) 188
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
PscI ACATGT 1 cut(s) 66
SaqAI TTAA 2 cut(s) 174, 198
SchI GAGTC 1 cut(s) 31
SetI ASST 3 cut(s) 159, 181, 241
Sse9I AATT 3 cut(s) 60, 200, 210
StyI CCWWGG 1 cut(s) 187
TaaI ACNGT 1 cut(s) 142
TaiI ACGT 1 cut(s) 181
TaqI TCGA 1 cut(s) 35
TasI AATT 3 cut(s) 60, 200, 210
Tru1I TTAA 2 cut(s) 174, 198
Tru9I TTAA 2 cut(s) 174, 198
TscAI CASTG 2 cut(s) 18, 115
TspDTI ATGAA 1 cut(s) 38
TspRI CASTG 2 cut(s) 18, 115
Van91I CCANNNNNTGG 1 cut(s) 188
XapI RAATTY 2 cut(s) 60, 200
XceI RCATGY 1 cut(s) 70
XcmI CCANNNNNNNNNTGG 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.