RchiOBHm_Chr5g0005061

serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0030288
Physical Location & Seq
Forward (+)
3312198 .. 3312564
367 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28629

Sequence Viewer

Length: 204 bp
ATGGAGAGTATTCCTATGTGGTACACAAATGTGTCGCAGTTGGTCCAAAACTCAAGCACTTTATCTGCACAGCTTTTAGATACAGGAAATTTAGTTCTCTTCCAGGATGATAAAACTAGGATATTTATATGGCAAAGTTTTGATTATCTTACAGATACTCTAATCCCAGGTATGAAAGTGGGGATAATTGGGAAACTGGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase Pkinase_Tyr S_locus_glycop

Protein Analysis

67

Amino Acids

7.55

Weight (kDa)

4.46

Isoelectric Point (pI)

9.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 5 - 62 1.9e-16 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030288)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0005061
rosa_roxburghii Rroxscaffold_2G00111830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 88
AfaI GTAC 1 cut(s) 23
AjnI CCWGG 2 cut(s) 102, 166
AleI CACNNNNGTG 1 cut(s) 29
AloI GAACNNNNNNTCC 2 cut(s) 78, 110
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
ApoI RAATTY 1 cut(s) 88
AspS9I GGNCC 1 cut(s) 43
AvaII GGWCC 1 cut(s) 43
BciT130I CCWGG 2 cut(s) 104, 168
BfaI CTAG 2 cut(s) 117, 202
Bme1390I CCNGG 2 cut(s) 104, 168
Bme18I GGWCC 1 cut(s) 43
BmgT120I GGNCC 1 cut(s) 43
BmrFI CCNGG 2 cut(s) 104, 168
BpuEI CTTGAG 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 201
BseBI CCWGG 2 cut(s) 104, 168
BseDI CCNNGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 112
BseNI ACTGG 1 cut(s) 201
BsgI GTGCAG 1 cut(s) 51
BsrI ACTGG 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 166
Bst2UI CCWGG 2 cut(s) 104, 168
Bst6I CTCTTC 1 cut(s) 104
BstF5I GGATG 1 cut(s) 112
BstNI CCWGG 2 cut(s) 104, 168
BstSCI CCNGG 2 cut(s) 102, 166
BtsCI GGATG 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 43
Csp6I GTAC 1 cut(s) 22
CviJI RGCY 2 cut(s) 73, 201
CviKI_1 RGCY 2 cut(s) 73, 201
CviQI GTAC 1 cut(s) 22
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
Eco47I GGWCC 1 cut(s) 43
EcoRII CCWGG 2 cut(s) 102, 166
FaiI YATR 4 cut(s) 17, 128, 130, 173
FokI GGATG 1 cut(s) 119
FspBI CTAG 2 cut(s) 117, 202
Hpy166II GTNNAC 1 cut(s) 24
Hpy8I GTNNAC 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 68
LpnPI CCDG 6 cut(s) 69, 89, 116, 153, 180, 182
MaeI CTAG 2 cut(s) 117, 202
MboII GAAGA 1 cut(s) 91
MluCI AATT 2 cut(s) 88, 186
MslI CAYNNNNRTG 1 cut(s) 29
MspR9I CCNGG 2 cut(s) 104, 168
MvaI CCWGG 2 cut(s) 104, 168
OliI CACNNNNGTG 1 cut(s) 29
PfoI TCCNGGA 1 cut(s) 102
Psp6I CCWGG 2 cut(s) 102, 166
PspGI CCWGG 2 cut(s) 102, 166
PspPI GGNCC 1 cut(s) 43
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
RseI CAYNNNNRTG 1 cut(s) 29
Sau96I GGNCC 1 cut(s) 43
ScrFI CCNGG 2 cut(s) 104, 168
SetI ASST 2 cut(s) 75, 172
SgeI CNNG 7 cut(s) 66, 96, 115, 116, 129, 179, 180
SinI GGWCC 1 cut(s) 43
SmiMI CAYNNNNRTG 1 cut(s) 29
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
Sse9I AATT 2 cut(s) 88, 186
SspMI CTAG 2 cut(s) 117, 202
StyD4I CCNGG 2 cut(s) 102, 166
TasI AATT 2 cut(s) 88, 186
TspDTI ATGAA 1 cut(s) 188
VpaK11BI GGWCC 1 cut(s) 43
XapI RAATTY 1 cut(s) 88
XspI CTAG 2 cut(s) 117, 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.