RchiOBHm_Chr5g0007011

May participate in a complex which severs microtubules in an ATP-dependent manner. Microtubule severing may promote rapid reorganization of cellular microtubule arrays

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
4347150 .. 4347573
424 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28811

Sequence Viewer

Length: 255 bp
ATGGACACTAATCTGAAGATCTGGGACATTAGAAAGAAGGGATGCATCCACACATACAAAGGTCATACTCAAGGCATTAGTACTATTAAGTTCACTCCCGATGGTCGATGGGTAGTTTCTGGTGGGTTTGACAATGTTCTAAAGGTGTGGGATCTAACTGCTGGGAAGCTCTTGCATGATTTTAAATTCCATGAACGACATATTCGGTCTATAGATTTTCACCCCCTTGAGTTTCTCTTGGCCACAGGTGAGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.74

Weight (kDa)

8.86

Isoelectric Point (pI)

9.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Beta-prop_Aladin PF25460 1 - 54 7.9e-07 Aladin seven-bladed propeller
WD40_WDHD1_1st PF24817 2 - 68 1e-08 WDHD1 first WD40 domain
Beta-prop_EML_2 PF23414 2 - 83 3e-07 Echinoderm microtubule-associated protein second beta-propeller
Beta-prop_TEP1_2nd PF25047 2 - 67 2.6e-06 TEP-1 second beta-propeller
EIF3I PF24805 2 - 75 3.9e-08 EIF3I
WD40_Gbeta PF25391 2 - 83 2.2e-10 G protein beta WD-40 repeat protein
WD40_CDC20-Fz PF24807 2 - 83 2.3e-13 CDC20/Fizzy WD40 domain
WD40_Prp19 PF24814 2 - 82 1.6e-13 Prp19 WD40 domain
Beta-prop_WDR36-Utp21_2nd PF25168 2 - 82 9.9e-15 WDR36/Utp21 second beta-propeller domain
Beta-prop_THOC3 PF25174 2 - 82 1e-15 THOC3 beta-propeller domain
Beta-prop_WDR3_1st PF25173 2 - 83 4.6e-16 WDR3 first beta-propeller domain
Beta-prop_WDR5 PF25175 2 - 82 3.2e-19 WDR5 beta-propeller domain
WDR55 PF24796 4 - 57 2.4e-07 WDR55
Beta-prop_WDR3_2nd PF25172 4 - 75 3.2e-08 WDR3 second beta-propeller domain
Beta-prop_WDR36-Utp21_1st PF25171 4 - 50 3.2e-06 WDR36/Utp21 first beta-propeller
Beta-prop_EML PF23409 4 - 77 6.4e-07 Echinoderm microtubule-associated protein first beta-propeller
WD40_MABP1-WDR62_1st PF24780 8 - 72 8.5e-06 MABP1/WDR62 first WD40 domain
Beta-prop_SPT8 PF23798 13 - 77 1.8e-06 SPT8 beta propeller
WD40 PF00400 15 - 51 5.1e-13 WD domain, G-beta repeat
Beta-prop_CAF1B_HIR1 PF24105 16 - 82 1.3e-07 CAF1B/HIR1 beta-propeller domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030223)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0007011
rosa_multiflora Rmu_sc0010774.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 159
AcoI YGGCCR 1 cut(s) 240
AcsI RAATTY 1 cut(s) 185
AcuI CTGAAG 1 cut(s) 35
AfaI GTAC 1 cut(s) 82
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
AlwI GGATC 1 cut(s) 159
AoxI GGCC 1 cut(s) 240
ApoI RAATTY 1 cut(s) 185
AsuHPI GGTGA 1 cut(s) 212
BalI TGGCCA 1 cut(s) 242
BccI CCATC 2 cut(s) 95, 102
BfmI CTRYAG 1 cut(s) 210
BglII AGATCT 1 cut(s) 18
BmcAI AGTACT 1 cut(s) 82
BmsI GCATC 2 cut(s) 32, 54
BpuEI CTTGAG 2 cut(s) 54, 248
BseGI GGATG 2 cut(s) 45, 47
BseYI CCCAGC 1 cut(s) 161
BshFI GGCC 1 cut(s) 242
BslFI GGGAC 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 38
BsnI GGCC 1 cut(s) 242
Bsp143I GATC 2 cut(s) 18, 151
BspANI GGCC 1 cut(s) 242
BspPI GGATC 1 cut(s) 159
BssMI GATC 2 cut(s) 18, 151
BstF5I GGATG 2 cut(s) 45, 47
BstKTI GATC 2 cut(s) 21, 154
BstMBI GATC 2 cut(s) 18, 151
BstSFI CTRYAG 1 cut(s) 210
BstX2I RGATCY 2 cut(s) 18, 151
BstYI RGATCY 2 cut(s) 18, 151
BsuRI GGCC 1 cut(s) 242
BtsCI GGATG 2 cut(s) 45, 47
Csp6I GTAC 1 cut(s) 81
CviAII CATG 2 cut(s) 176, 191
CviJI RGCY 2 cut(s) 169, 242
CviKI_1 RGCY 2 cut(s) 169, 242
CviQI GTAC 1 cut(s) 81
DpnI GATC 2 cut(s) 20, 153
DpnII GATC 2 cut(s) 18, 151
DraI TTTAAA 1 cut(s) 184
EaeI YGGCCR 1 cut(s) 240
Eco57I CTGAAG 1 cut(s) 35
EcoT22I ATGCAT 1 cut(s) 47
FaeI CATG 2 cut(s) 179, 194
FaiI YATR 6 cut(s) 55, 66, 177, 192, 201, 212
FaqI GGGAC 1 cut(s) 38
FatI CATG 2 cut(s) 175, 190
FokI GGATG 2 cut(s) 32, 54
GsaI CCCAGC 1 cut(s) 165
HaeIII GGCC 1 cut(s) 242
Hin1II CATG 2 cut(s) 179, 194
HphI GGTGA 1 cut(s) 212
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 45, 175
Hsp92II CATG 2 cut(s) 179, 194
Kzo9I GATC 2 cut(s) 18, 151
LpnPI CCDG 4 cut(s) 7, 105, 147, 231
LweI GCATC 2 cut(s) 32, 54
MalI GATC 2 cut(s) 20, 153
MboI GATC 2 cut(s) 18, 151
MboII GAAGA 1 cut(s) 28
MflI RGATCY 2 cut(s) 18, 151
MlsI TGGCCA 1 cut(s) 242
MluCI AATT 1 cut(s) 185
MluNI TGGCCA 1 cut(s) 242
Mox20I TGGCCA 1 cut(s) 242
Mph1103I ATGCAT 1 cut(s) 47
MscI TGGCCA 1 cut(s) 242
MseI TTAA 2 cut(s) 87, 183
Msp20I TGGCCA 1 cut(s) 242
NdeII GATC 2 cut(s) 18, 151
NlaIII CATG 2 cut(s) 179, 194
NsiI ATGCAT 1 cut(s) 47
PspFI CCCAGC 1 cut(s) 161
PsuI RGATCY 2 cut(s) 18, 151
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 2 cut(s) 87, 183
Sau3AI GATC 2 cut(s) 18, 151
ScaI AGTACT 1 cut(s) 82
SetI ASST 4 cut(s) 64, 147, 171, 250
SfaNI GCATC 2 cut(s) 32, 54
SfcI CTRYAG 1 cut(s) 210
SmlI CTYRAG 2 cut(s) 69, 227
SmoI CTYRAG 2 cut(s) 69, 227
Sse9I AATT 1 cut(s) 185
TaqI TCGA 1 cut(s) 106
TaqII GACCGA 1 cut(s) 195
TasI AATT 1 cut(s) 185
TatI WGTACW 1 cut(s) 80
Tru1I TTAA 2 cut(s) 87, 183
Tru9I TTAA 2 cut(s) 87, 183
TspDTI ATGAA 1 cut(s) 207
XapI RAATTY 1 cut(s) 185
ZrmI AGTACT 1 cut(s) 82
Zsp2I ATGCAT 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.