Rmu_sc0010774.1_g000001

May participate in a complex which severs microtubules in an ATP-dependent manner. Microtubule severing may promote rapid reorganization of cellular microtubule arrays

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010774.1
Physical Location & Seq
Reverse (-)
15420 .. 15786
367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010774.1_g000001.1.cds

Sequence Viewer

Length: 255 bp
atggacactaatctgaagatctgggacattagaaagaagggatgcatccacacatacaaaggtcatactcaaggcattagtactattaagttcactcccgatggtcgatgggtagtttctggtggctttgacaatgttgtaaaggtgtgggatctaactgctgggaagatcttgcatgattttaaattccatgaacgacctattcggtctatagattttcatccccttgagtttctcttggccacaggtgagtga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.68

Weight (kDa)

8.85

Isoelectric Point (pI)

7.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030223)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0007011
rosa_multiflora Rmu_sc0010774.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 159
AcoI YGGCCR 1 cut(s) 240
AcsI RAATTY 1 cut(s) 185
AcuI CTGAAG 1 cut(s) 35
AfaI GTAC 1 cut(s) 82
AlwI GGATC 1 cut(s) 159
AoxI GGCC 1 cut(s) 240
ApoI RAATTY 1 cut(s) 185
BalI TGGCCA 1 cut(s) 242
BccI CCATC 2 cut(s) 95, 102
BfmI CTRYAG 1 cut(s) 210
BglII AGATCT 2 cut(s) 18, 168
BmcAI AGTACT 1 cut(s) 82
BmsI GCATC 2 cut(s) 32, 54
BpuEI CTTGAG 2 cut(s) 54, 248
BsaBI GATNNNNATC 1 cut(s) 219
Bse8I GATNNNNATC 1 cut(s) 219
BseGI GGATG 3 cut(s) 45, 47, 220
BseJI GATNNNNATC 1 cut(s) 219
BseYI CCCAGC 1 cut(s) 161
BshFI GGCC 1 cut(s) 242
BslFI GGGAC 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 38
BsnI GGCC 1 cut(s) 242
Bsp143I GATC 3 cut(s) 18, 151, 168
BspANI GGCC 1 cut(s) 242
BspPI GGATC 1 cut(s) 159
BssMI GATC 3 cut(s) 18, 151, 168
BstF5I GGATG 3 cut(s) 45, 47, 220
BstKTI GATC 3 cut(s) 21, 154, 171
BstMBI GATC 3 cut(s) 18, 151, 168
BstSFI CTRYAG 1 cut(s) 210
BstX2I RGATCY 3 cut(s) 18, 151, 168
BstYI RGATCY 3 cut(s) 18, 151, 168
BsuRI GGCC 1 cut(s) 242
BtsCI GGATG 3 cut(s) 45, 47, 220
Csp6I GTAC 1 cut(s) 81
CviAII CATG 2 cut(s) 176, 191
CviJI RGCY 2 cut(s) 126, 242
CviKI_1 RGCY 2 cut(s) 126, 242
CviQI GTAC 1 cut(s) 81
DpnI GATC 3 cut(s) 20, 153, 170
DpnII GATC 3 cut(s) 18, 151, 168
DraI TTTAAA 1 cut(s) 184
EaeI YGGCCR 1 cut(s) 240
Eco57I CTGAAG 1 cut(s) 35
EcoT22I ATGCAT 1 cut(s) 47
FaeI CATG 2 cut(s) 179, 194
FaiI YATR 5 cut(s) 55, 66, 177, 192, 212
FaqI GGGAC 1 cut(s) 38
FatI CATG 2 cut(s) 175, 190
FokI GGATG 3 cut(s) 32, 54, 207
GsaI CCCAGC 1 cut(s) 165
HaeIII GGCC 1 cut(s) 242
Hin1II CATG 2 cut(s) 179, 194
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 45, 175
Hsp92II CATG 2 cut(s) 179, 194
Kzo9I GATC 3 cut(s) 18, 151, 168
LpnPI CCDG 4 cut(s) 7, 105, 147, 231
LweI GCATC 2 cut(s) 32, 54
MalI GATC 3 cut(s) 20, 153, 170
MboI GATC 3 cut(s) 18, 151, 168
MboII GAAGA 2 cut(s) 28, 178
MflI RGATCY 3 cut(s) 18, 151, 168
MlsI TGGCCA 1 cut(s) 242
MluCI AATT 1 cut(s) 185
MluNI TGGCCA 1 cut(s) 242
Mox20I TGGCCA 1 cut(s) 242
Mph1103I ATGCAT 1 cut(s) 47
MscI TGGCCA 1 cut(s) 242
MseI TTAA 2 cut(s) 87, 183
Msp20I TGGCCA 1 cut(s) 242
NdeII GATC 3 cut(s) 18, 151, 168
NlaIII CATG 2 cut(s) 179, 194
NsiI ATGCAT 1 cut(s) 47
PspFI CCCAGC 1 cut(s) 161
PsuI RGATCY 3 cut(s) 18, 151, 168
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 2 cut(s) 87, 183
Sau3AI GATC 3 cut(s) 18, 151, 168
ScaI AGTACT 1 cut(s) 82
SetI ASST 4 cut(s) 64, 147, 202, 250
SfaNI GCATC 2 cut(s) 32, 54
SfcI CTRYAG 1 cut(s) 210
SmlI CTYRAG 2 cut(s) 69, 227
SmoI CTYRAG 2 cut(s) 69, 227
Sse9I AATT 1 cut(s) 185
TaqI TCGA 1 cut(s) 106
TaqII GACCGA 1 cut(s) 195
TasI AATT 1 cut(s) 185
TatI WGTACW 1 cut(s) 80
Tru1I TTAA 2 cut(s) 87, 183
Tru9I TTAA 2 cut(s) 87, 183
TspDTI ATGAA 2 cut(s) 207, 209
XapI RAATTY 1 cut(s) 185
ZrmI AGTACT 1 cut(s) 82
Zsp2I ATGCAT 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.