RchiOBHm_Chr5g0025281

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
19199095 .. 19199611
517 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30496

Sequence Viewer

Length: 225 bp
ATGAATCCCAAAATTTCTGATTTTGGCATGGCACACATTTTCACGCACAATGAACTGGAGGCAAATACTAATAGGGTCGTGCGTGTGAACATGGCGTGGGAATTGTGGAAGGATGGTCGTGGGCTAGAATTCATGGATCCAACACCATCTGATTTCATGTATGAAGGGTCAATTGTTAAGATGCATCCATGTCGGTCTGCTATGCGTGGAAGAAAATGCAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.58

Weight (kDa)

7.85

Isoelectric Point (pI)

34.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022770)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0025061 RchiOBHm_Chr5g0025281
rosa_roxburghii Rroxscaffold_3G00223460
rosa_samantha Rh5CG194900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 131, 144
AcsI RAATTY 2 cut(s) 12, 128
AlwI GGATC 2 cut(s) 131, 144
ApoI RAATTY 2 cut(s) 12, 128
BamHI GGATCC 1 cut(s) 136
BccI CCATC 2 cut(s) 107, 154
BcgI CGANNNNNNTGC 2 cut(s) 173, 207
BfaI CTAG 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 138
BmsI GCATC 2 cut(s) 171, 193
BpmI CTGGAG 1 cut(s) 77
Bse1I ACTGG 1 cut(s) 60
BseGI GGATG 2 cut(s) 118, 184
BseNI ACTGG 1 cut(s) 60
Bsp143I GATC 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 2 cut(s) 131, 144
BsrI ACTGG 1 cut(s) 60
BssMI GATC 1 cut(s) 136
BstF5I GGATG 2 cut(s) 118, 184
BstKTI GATC 1 cut(s) 139
BstMBI GATC 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 136
BstYI RGATCY 1 cut(s) 136
BtsCI GGATG 2 cut(s) 118, 184
CviAII CATG 5 cut(s) 28, 91, 133, 157, 189
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
DpnI GATC 1 cut(s) 138
DpnII GATC 1 cut(s) 136
EcoRI GAATTC 1 cut(s) 128
EcoT22I ATGCAT 1 cut(s) 186
FaeI CATG 5 cut(s) 31, 94, 136, 160, 192
FaiI YATR 7 cut(s) 29, 92, 134, 158, 162, 190, 203
FatI CATG 5 cut(s) 27, 90, 132, 156, 188
FokI GGATG 2 cut(s) 125, 171
FspBI CTAG 1 cut(s) 125
GsuI CTGGAG 1 cut(s) 77
Hin1II CATG 5 cut(s) 31, 94, 136, 160, 192
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 19, 151
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 2 cut(s) 103, 158
HpyCH4V TGCA 2 cut(s) 184, 219
Hsp92II CATG 5 cut(s) 31, 94, 136, 160, 192
Kzo9I GATC 1 cut(s) 136
LpnPI CCDG 1 cut(s) 41
LweI GCATC 2 cut(s) 171, 193
MaeI CTAG 1 cut(s) 125
MalI GATC 1 cut(s) 138
MboI GATC 1 cut(s) 136
MboII GAAGA 1 cut(s) 222
MfeI CAATTG 1 cut(s) 171
MflI RGATCY 1 cut(s) 136
MluCI AATT 4 cut(s) 12, 101, 128, 171
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 1 cut(s) 52
Mph1103I ATGCAT 1 cut(s) 186
MseI TTAA 1 cut(s) 177
MunI CAATTG 1 cut(s) 171
NdeII GATC 1 cut(s) 136
NlaIII CATG 5 cut(s) 31, 94, 136, 160, 192
NlaIV GGNNCC 1 cut(s) 138
NsiI ATGCAT 1 cut(s) 186
PfeI GAWTC 1 cut(s) 4
PspN4I GGNNCC 1 cut(s) 138
PsuI RGATCY 1 cut(s) 136
SaqAI TTAA 1 cut(s) 177
Sau3AI GATC 1 cut(s) 136
SfaNI GCATC 2 cut(s) 171, 193
Sse9I AATT 4 cut(s) 12, 101, 128, 171
SspMI CTAG 1 cut(s) 125
TaqII GACCGA 1 cut(s) 183
TasI AATT 4 cut(s) 12, 101, 128, 171
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TspDTI ATGAA 5 cut(s) 17, 66, 121, 145, 177
XapI RAATTY 2 cut(s) 12, 128
XspI CTAG 1 cut(s) 125
Zsp2I ATGCAT 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.