RchiOBHm_Chr5g0025301

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
19205028 .. 19205204
177 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30497

Sequence Viewer

Length: 177 bp
ATGAGGGGATTTTTTTCCATAAAATCCGATGTGTATAGTTTTGGAGTACTAATACTTGAGATCATAAGTGGTAGGAGAAACACGAGCTTCTACGATGATGATCGTGTGGTCAATACAGTGGGATATGTATGTGCATATATTAAGCAGATCTCTCTTATCCATAGAGTACTATTCTAG

Protein Analysis

58

Amino Acids

6.72

Weight (kDa)

8.98

Isoelectric Point (pI)

30.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021416)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 48, 168
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
BauI CACGAG 1 cut(s) 82
BfaI CTAG 1 cut(s) 175
BglII AGATCT 1 cut(s) 147
BmcAI AGTACT 2 cut(s) 48, 168
BpuEI CTTGAG 1 cut(s) 77
BsaBI GATNNNNATC 1 cut(s) 99
Bse8I GATNNNNATC 1 cut(s) 99
BseJI GATNNNNATC 1 cut(s) 99
Bsp143I GATC 3 cut(s) 60, 100, 147
BssMI GATC 3 cut(s) 60, 100, 147
BssSI CACGAG 1 cut(s) 82
Bst2BI CACGAG 1 cut(s) 82
Bst4CI ACNGT 1 cut(s) 118
BstKTI GATC 3 cut(s) 63, 103, 150
BstMBI GATC 3 cut(s) 60, 100, 147
BstX2I RGATCY 1 cut(s) 147
BstYI RGATCY 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 123
Csp6I GTAC 2 cut(s) 47, 167
CviJI RGCY 1 cut(s) 87
CviKI_1 RGCY 1 cut(s) 87
CviQI GTAC 2 cut(s) 47, 167
DpnI GATC 3 cut(s) 62, 102, 149
DpnII GATC 3 cut(s) 60, 100, 147
FaiI YATR 8 cut(s) 20, 36, 65, 126, 130, 136, 138, 162
FspBI CTAG 1 cut(s) 175
FspEI CC 9 cut(s) 27, 31, 40, 54, 58, 92, 104, 105, 173
Hpy188I TCNGA 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 134
Kzo9I GATC 3 cut(s) 60, 100, 147
MaeI CTAG 1 cut(s) 175
MalI GATC 3 cut(s) 62, 102, 149
MboI GATC 3 cut(s) 60, 100, 147
MflI RGATCY 1 cut(s) 147
MseI TTAA 1 cut(s) 141
NdeII GATC 3 cut(s) 60, 100, 147
PsuI RGATCY 1 cut(s) 147
RsaI GTAC 2 cut(s) 48, 168
RsaNI GTAC 2 cut(s) 47, 167
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 3 cut(s) 60, 100, 147
ScaI AGTACT 2 cut(s) 48, 168
SetI ASST 1 cut(s) 89
SgeI CNNG 4 cut(s) 68, 94, 96, 116
SmlI CTYRAG 1 cut(s) 56
SmoI CTYRAG 1 cut(s) 56
SspMI CTAG 1 cut(s) 175
TaaI ACNGT 1 cut(s) 118
TatI WGTACW 2 cut(s) 46, 166
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TscAI CASTG 1 cut(s) 123
TspRI CASTG 1 cut(s) 123
XspI CTAG 1 cut(s) 175
ZrmI AGTACT 2 cut(s) 48, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.