RchiOBHm_Chr5g0030311

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0030224
Physical Location & Seq
Reverse (-)
24019844 .. 24020263
420 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30964

Sequence Viewer

Length: 420 bp
ATGTTGATCACTCCTAATCAGTTAGGATCCTTTCCTTTAATAGGAGAGGCAATAAAGCCTACTTATGTTGCTTTCATGGCTGCATTGACTGCGTGTAGCCATGCTGGATTGGTAGACGAAGCTTGGAAGTATTATAATAGTATGACCAAAAAATATAGGATTGCTCTAGGTATAGAGCACTATGCTGCTGTTGCAGACCTTCTTGGTAGAGCTGGAAGGTTGGACAAAGCTTATCGCTTTATCTCTAGCATGCATATAGAACCAACAGGAAGTGTATGGTCAACATTGTTGGCTGCTTGTGGAGTTCACAAGAATGTTGAATTGGCAGAAAAGGTTGCTGAAAAAATATTTGTTGTTGATCCTGAGAACAGTGGATCTTATGTGCTTTTGTCAAATATATATTCTGCTGCTAAGAAATGA

Protein Analysis

139

Amino Acids

15.17

Weight (kDa)

8.5

Isoelectric Point (pI)

35.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
E_motif PF20431 103 - 138 3.2e-09 E motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030224)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0030311
rosa_multiflora Rmu_sc0001886.1_g000009

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 135
AccI GTMKAC 1 cut(s) 114
AclWI GGATC 4 cut(s) 21, 34, 353, 382
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 1 cut(s) 320
AjuI GAANNNNNNNTTGG 2 cut(s) 305, 337
AluBI AGCT 3 cut(s) 122, 212, 230
AluI AGCT 3 cut(s) 122, 212, 230
Alw21I GWGCWC 1 cut(s) 180
AlwI GGATC 4 cut(s) 21, 34, 353, 382
ApeKI GCWGC 4 cut(s) 80, 185, 293, 407
BamHI GGATCC 1 cut(s) 26
Bbv12I GWGCWC 1 cut(s) 180
BbvI GCAGC 4 cut(s) 67, 172, 280, 394
BclI TGATCA 1 cut(s) 6
BfaI CTAG 2 cut(s) 167, 246
BisI GCNGC 4 cut(s) 81, 186, 294, 408
BlsI GCNGC 4 cut(s) 82, 187, 295, 409
BmiI GGNNCC 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 354
BseXI GCAGC 4 cut(s) 67, 172, 280, 394
BsiHKAI GWGCWC 1 cut(s) 180
BslI CCNNNNNNNGG 1 cut(s) 41
Bsp1286I GDGCHC 1 cut(s) 180
Bsp143I GATC 4 cut(s) 6, 26, 358, 374
BspCNI CTCAG 1 cut(s) 355
BspLI GGNNCC 1 cut(s) 28
BspPI GGATC 4 cut(s) 21, 34, 353, 382
BssMI GATC 4 cut(s) 6, 26, 358, 374
Bst4CI ACNGT 1 cut(s) 371
BstAPI GCANNNNNTGC 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 251
BstDEI CTNAG 2 cut(s) 363, 411
BstENI CCTNNNNNAGG 1 cut(s) 39
BstKTI GATC 4 cut(s) 9, 29, 361, 377
BstMBI GATC 4 cut(s) 6, 26, 358, 374
BstMWI GCNNNNNNNGC 3 cut(s) 77, 89, 191
BstNSI RCATGY 1 cut(s) 253
BstV1I GCAGC 4 cut(s) 67, 172, 280, 394
BstX2I RGATCY 2 cut(s) 26, 374
BstYI RGATCY 2 cut(s) 26, 374
BtsIMutI CAGTG 1 cut(s) 376
Cac8I GCNNGC 1 cut(s) 251
CviAII CATG 3 cut(s) 76, 101, 250
CviJI RGCY 7 cut(s) 58, 80, 99, 122, 212, 230, 293
CviKI_1 RGCY 7 cut(s) 58, 80, 99, 122, 212, 230, 293
DdeI CTNAG 2 cut(s) 363, 411
DpnI GATC 4 cut(s) 8, 28, 360, 376
DpnII GATC 4 cut(s) 6, 26, 358, 374
EcoNI CCTNNNNNAGG 1 cut(s) 39
EcoT22I ATGCAT 1 cut(s) 255
FaeI CATG 3 cut(s) 79, 104, 253
FatI CATG 3 cut(s) 75, 100, 249
FbaI TGATCA 1 cut(s) 6
FblI GTMKAC 1 cut(s) 114
Fnu4HI GCNGC 4 cut(s) 81, 186, 294, 408
Fsp4HI GCNGC 4 cut(s) 81, 186, 294, 408
FspBI CTAG 2 cut(s) 167, 246
GluI GCNGC 4 cut(s) 81, 186, 294, 408
Hin1II CATG 3 cut(s) 79, 104, 253
HincII GTYRAC 1 cut(s) 282
HindII GTYRAC 1 cut(s) 282
HindIII AAGCTT 2 cut(s) 120, 228
Hpy166II GTNNAC 3 cut(s) 115, 282, 307
Hpy188III TCNNGA 1 cut(s) 362
Hpy8I GTNNAC 3 cut(s) 115, 282, 307
HpyAV CCTTC 2 cut(s) 209, 210
HpyCH4III ACNGT 1 cut(s) 371
HpyCH4V TGCA 3 cut(s) 83, 194, 253
HpyF10VI GCNNNNNNNGC 3 cut(s) 77, 89, 191
HpyF3I CTNAG 2 cut(s) 363, 411
Hsp92II CATG 3 cut(s) 79, 104, 253
Ksp22I TGATCA 1 cut(s) 6
Kzo9I GATC 4 cut(s) 6, 26, 358, 374
LpnPI CCDG 4 cut(s) 90, 198, 252, 375
Lsp1109I GCAGC 4 cut(s) 67, 172, 280, 394
MaeI CTAG 2 cut(s) 167, 246
MalI GATC 4 cut(s) 8, 28, 360, 376
MboI GATC 4 cut(s) 6, 26, 358, 374
MflI RGATCY 2 cut(s) 26, 374
MhlI GDGCHC 1 cut(s) 180
MluCI AATT 1 cut(s) 320
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 1 cut(s) 40
Mph1103I ATGCAT 1 cut(s) 255
MseI TTAA 1 cut(s) 38
MslI CAYNNNNRTG 1 cut(s) 312
MwoI GCNNNNNNNGC 3 cut(s) 77, 89, 191
NdeII GATC 4 cut(s) 6, 26, 358, 374
NlaIII CATG 3 cut(s) 79, 104, 253
NlaIV GGNNCC 1 cut(s) 28
NsiI ATGCAT 1 cut(s) 255
NspI RCATGY 1 cut(s) 253
PaeI GCATGC 1 cut(s) 253
PkrI GCNGC 4 cut(s) 82, 187, 295, 409
PsiI TTATAA 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 28
PsuI RGATCY 2 cut(s) 26, 374
RseI CAYNNNNRTG 1 cut(s) 312
SaqAI TTAA 1 cut(s) 38
SatI GCNGC 4 cut(s) 81, 186, 294, 408
Sau3AI GATC 4 cut(s) 6, 26, 358, 374
SduI GDGCHC 1 cut(s) 180
SetI ASST 7 cut(s) 124, 172, 201, 214, 221, 232, 336
SmiMI CAYNNNNRTG 1 cut(s) 312
SphI GCATGC 1 cut(s) 253
Sse9I AATT 1 cut(s) 320
SspI AATATT 1 cut(s) 348
SspMI CTAG 2 cut(s) 167, 246
TaaI ACNGT 1 cut(s) 371
TasI AATT 1 cut(s) 320
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TscAI CASTG 1 cut(s) 376
TseI GCWGC 4 cut(s) 80, 185, 293, 407
TspDTI ATGAA 1 cut(s) 64
TspRI CASTG 1 cut(s) 376
XagI CCTNNNNNAGG 1 cut(s) 39
XceI RCATGY 1 cut(s) 253
XmiI GTMKAC 1 cut(s) 114
XspI CTAG 2 cut(s) 167, 246
Zsp2I ATGCAT 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.