Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001886.1

Orthogroup ID

OG0030224

Physical Location & Seq

Genomic Coordinates Reverse (-)

45655 .. 46008

Gene Structure 354 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001886.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

atgactgtgggatatgcattgcagggtcatgcccatgataccatttccttatttgagctgacgaaaggagaggcactaaagcctacttatgttgctttcatggctgtattgactgcgtgtagccgtgctggattggtagacgaagctcggaagtatcttaatagtatgacaaaaaaatataggattgctctaggtatagagcactatgctgctgttgcagaccttcttggtcgagctggaaggttggacaaagcttatcgctttatctctagcatgcatatagaaccaacaggaagtgtatggtcaacattgttggctgcttgtagagttcacaagaatgttgatcctggctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

117

Amino Acids

12.8

Weight (kDa)

9.2

Isoelectric Point (pI)

36.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030224)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0030311
rosa_multiflora	Rmu_sc0001886.1_g000009

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	138
AclWI	GGATC	1 cut(s)	338
AjnI	CCWGG	1 cut(s)	346
AluBI	AGCT	4 cut(s)	58, 146, 236, 254
AluI	AGCT	4 cut(s)	58, 146, 236, 254
Alw21I	GWGCWC	1 cut(s)	204
AlwI	GGATC	1 cut(s)	338
ApeKI	GCWGC	2 cut(s)	209, 317
Bbv12I	GWGCWC	1 cut(s)	204
BbvI	GCAGC	2 cut(s)	196, 304
BceAI	ACGGC	1 cut(s)	108
BciT130I	CCWGG	1 cut(s)	348
BfaI	CTAG	2 cut(s)	191, 270
BisI	GCNGC	2 cut(s)	210, 318
BlsI	GCNGC	2 cut(s)	211, 319
Bme1390I	CCNGG	1 cut(s)	348
BmrFI	CCNGG	1 cut(s)	348
Bse3DI	GCAATG	1 cut(s)	17
BseBI	CCWGG	1 cut(s)	348
BseMI	GCAATG	1 cut(s)	17
BseXI	GCAGC	2 cut(s)	196, 304
BsiHKAI	GWGCWC	1 cut(s)	204
Bsp1286I	GDGCHC	1 cut(s)	204
Bsp143I	GATC	1 cut(s)	343
BspPI	GGATC	1 cut(s)	338
BsrDI	GCAATG	1 cut(s)	17
BssMI	GATC	1 cut(s)	343
Bst2UI	CCWGG	1 cut(s)	348
Bst4CI	ACNGT	1 cut(s)	7
BstC8I	GCNNGC	1 cut(s)	275
BstKTI	GATC	1 cut(s)	346
BstMBI	GATC	1 cut(s)	343
BstMWI	GCNNNNNNNGC	2 cut(s)	101, 215
BstNI	CCWGG	1 cut(s)	348
BstNSI	RCATGY	1 cut(s)	277
BstSCI	CCNGG	1 cut(s)	346
BstV1I	GCAGC	2 cut(s)	196, 304
Cac8I	GCNNGC	1 cut(s)	275
CviAII	CATG	4 cut(s)	29, 35, 100, 274
CviJI	RGCY	9 cut(s)	58, 82, 104, 123, 146, 236, 254, 317, 351
CviKI_1	RGCY	9 cut(s)	58, 82, 104, 123, 146, 236, 254, 317, 351
DpnI	GATC	1 cut(s)	345
DpnII	GATC	1 cut(s)	343
EcoRII	CCWGG	1 cut(s)	346
EcoT22I	ATGCAT	2 cut(s)	19, 279
FaeI	CATG	4 cut(s)	32, 38, 103, 277
FatI	CATG	4 cut(s)	28, 34, 99, 273
FblI	GTMKAC	1 cut(s)	138
Fnu4HI	GCNGC	2 cut(s)	210, 318
Fsp4HI	GCNGC	2 cut(s)	210, 318
FspBI	CTAG	2 cut(s)	191, 270
GluI	GCNGC	2 cut(s)	210, 318
Hin1II	CATG	4 cut(s)	32, 38, 103, 277
HincII	GTYRAC	1 cut(s)	306
HindII	GTYRAC	1 cut(s)	306
HindIII	AAGCTT	1 cut(s)	252
Hpy166II	GTNNAC	3 cut(s)	139, 306, 331
Hpy188I	TCNGA	1 cut(s)	150
Hpy8I	GTNNAC	3 cut(s)	139, 306, 331
HpyAV	CCTTC	2 cut(s)	233, 234
HpyCH4III	ACNGT	1 cut(s)	7
HpyCH4V	TGCA	4 cut(s)	17, 22, 218, 277
HpyF10VI	GCNNNNNNNGC	2 cut(s)	101, 215
Hsp92II	CATG	4 cut(s)	32, 38, 103, 277
Kzo9I	GATC	1 cut(s)	343
LpnPI	CCDG	5 cut(s)	8, 114, 222, 276, 333
Lsp1109I	GCAGC	2 cut(s)	196, 304
MaeI	CTAG	2 cut(s)	191, 270
MalI	GATC	1 cut(s)	345
MboI	GATC	1 cut(s)	343
MhlI	GDGCHC	1 cut(s)	204
MmeI	TCCRAC	1 cut(s)	225
MnlI	CCTC	1 cut(s)	64
Mph1103I	ATGCAT	2 cut(s)	19, 279
MseI	TTAA	1 cut(s)	159
MslI	CAYNNNNRTG	2 cut(s)	33, 336
MspR9I	CCNGG	1 cut(s)	348
MvaI	CCWGG	1 cut(s)	348
MwoI	GCNNNNNNNGC	2 cut(s)	101, 215
NdeII	GATC	1 cut(s)	343
NlaIII	CATG	4 cut(s)	32, 38, 103, 277
NsiI	ATGCAT	2 cut(s)	19, 279
NspI	RCATGY	1 cut(s)	277
PaeI	GCATGC	1 cut(s)	277
PkrI	GCNGC	2 cut(s)	211, 319
Psp6I	CCWGG	1 cut(s)	346
PspGI	CCWGG	1 cut(s)	346
RseI	CAYNNNNRTG	2 cut(s)	33, 336
SaqAI	TTAA	1 cut(s)	159
SatI	GCNGC	2 cut(s)	210, 318
Sau3AI	GATC	1 cut(s)	343
ScrFI	CCNGG	1 cut(s)	348
SduI	GDGCHC	1 cut(s)	204
SetI	ASST	7 cut(s)	60, 148, 196, 225, 238, 245, 256
SmiMI	CAYNNNNRTG	2 cut(s)	33, 336
SphI	GCATGC	1 cut(s)	277
SspMI	CTAG	2 cut(s)	191, 270
StyD4I	CCNGG	1 cut(s)	346
TaaI	ACNGT	1 cut(s)	7
TaqI	TCGA	1 cut(s)	232
Tru1I	TTAA	1 cut(s)	159
Tru9I	TTAA	1 cut(s)	159
TseI	GCWGC	2 cut(s)	209, 317
TspDTI	ATGAA	1 cut(s)	88
XceI	RCATGY	1 cut(s)	277
XmiI	GTMKAC	1 cut(s)	138
XspI	CTAG	2 cut(s)	191, 270
Zsp2I	ATGCAT	2 cut(s)	19, 279

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.