RchiOBHm_Chr5g0038671

GDP-mannose transporter

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
33332643 .. 33333927
1285 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31727

Sequence Viewer

Length: 195 bp
ATGATATTGCTGAATAAAGTTGTTCTATCGAGTTACAACTTCAATGCAGGAGTTTCATTTATGTTTTATCAAATCCTGATTTCCTATTTTATGAAGACATCGCATCATGAAGAGTATCTCTGTGTCAAGATCTCATATCAAGGCATCGGAATTGGTGCGATGTTGGGAGATACAACAGAGTGGAGGAAATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.39

Weight (kDa)

7.79

Isoelectric Point (pI)

20.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022765)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0038671
rosa_rugosa Rorug04G0010900 Rorug05G0293700.1
rosa_samantha Rh2AG352500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 43
BbsI GAAGAC 1 cut(s) 101
BglII AGATCT 1 cut(s) 129
BmsI GCATC 2 cut(s) 112, 153
BpiI GAAGAC 1 cut(s) 101
BsaXI ACNNNNNCTCC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 129
BspHI TCATGA 1 cut(s) 106
BssMI GATC 1 cut(s) 129
Bst6I CTCTTC 1 cut(s) 105
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstV2I GAAGAC 1 cut(s) 101
BstX2I RGATCY 1 cut(s) 129
BstYI RGATCY 1 cut(s) 129
BtgZI GCGATG 2 cut(s) 84, 173
CciI TCATGA 1 cut(s) 106
CviAII CATG 1 cut(s) 107
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
FaeI CATG 1 cut(s) 110
FaiI YATR 4 cut(s) 62, 92, 108, 136
FatI CATG 1 cut(s) 106
Hin1II CATG 1 cut(s) 110
Hpy188I TCNGA 1 cut(s) 149
Hpy188III TCNNGA 3 cut(s) 76, 107, 127
HpyCH4V TGCA 1 cut(s) 47
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 1 cut(s) 129
LpnPI CCDG 2 cut(s) 33, 89
LweI GCATC 2 cut(s) 112, 153
MaeIII GTNAC 1 cut(s) 32
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MboII GAAGA 2 cut(s) 106, 122
MflI RGATCY 1 cut(s) 129
MluCI AATT 1 cut(s) 150
MnlI CCTC 1 cut(s) 177
NdeII GATC 1 cut(s) 129
NlaIII CATG 1 cut(s) 110
PagI TCATGA 1 cut(s) 106
PsuI RGATCY 1 cut(s) 129
Sau3AI GATC 1 cut(s) 129
SfaNI GCATC 2 cut(s) 112, 153
SgeI CNNG 6 cut(s) 42, 60, 88, 119, 139, 152
Sse9I AATT 1 cut(s) 150
TaqI TCGA 1 cut(s) 29
TasI AATT 1 cut(s) 150
TspDTI ATGAA 3 cut(s) 45, 107, 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.