RchiOBHm_Chr5g0042341

WD40 repeats

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
37092368 .. 37092655
288 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32075

Sequence Viewer

Length: 201 bp
ATGCAAAAGCAGTCTTTGCTACTGCTATGTTCCGAAAAAGCAGCATACATATATTCCTTCACACATGTCATGCTGGGAGTTAAGAAGGTAATATACAAGAAGAAATTTCAATCATCTTGTTGCTGGGCATCGACATTCTACACCTCTGATGTTGGCCTTATACTCGTTTTTACAACTGGAAAAATTGAGATAAGGTGGTGA

Protein Analysis

66

Amino Acids

7.63

Weight (kDa)

9.47

Isoelectric Point (pI)

57.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024959)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0434581 RchiOBHm_Chr5g0042341
rosa_samantha Rh5DG319200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 104
AflIII ACRYGT 1 cut(s) 64
AgsI TTSAA 1 cut(s) 110
AoxI GGCC 1 cut(s) 154
ApeKI GCWGC 1 cut(s) 41
ApoI RAATTY 1 cut(s) 104
BarI GAAGNNNNNNTAC 2 cut(s) 77, 109
BbvI GCAGC 1 cut(s) 53
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
BmsI GCATC 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 181
BseNI ACTGG 1 cut(s) 181
BseXI GCAGC 1 cut(s) 53
BseYI CCCAGC 2 cut(s) 73, 123
BshFI GGCC 1 cut(s) 156
BsnI GGCC 1 cut(s) 156
BspANI GGCC 1 cut(s) 156
BsrI ACTGG 1 cut(s) 181
BstAPI GCANNNNNTGC 1 cut(s) 16
BstMWI GCNNNNNNNGC 1 cut(s) 16
BstNSI RCATGY 1 cut(s) 68
BstV1I GCAGC 1 cut(s) 53
BsuRI GGCC 1 cut(s) 156
CviAII CATG 2 cut(s) 65, 70
CviJI RGCY 1 cut(s) 156
CviKI_1 RGCY 1 cut(s) 156
FaeI CATG 2 cut(s) 68, 73
FaiI YATR 8 cut(s) 28, 46, 50, 52, 66, 71, 94, 161
FatI CATG 2 cut(s) 64, 69
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
GluI GCNGC 1 cut(s) 42
GsaI CCCAGC 2 cut(s) 77, 127
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 2 cut(s) 68, 73
Hpy188I TCNGA 2 cut(s) 34, 148
HpyAV CCTTC 2 cut(s) 67, 79
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
Hsp92II CATG 2 cut(s) 68, 73
LpnPI CCDG 3 cut(s) 59, 109, 162
Lsp1109I GCAGC 1 cut(s) 53
LweI GCATC 1 cut(s) 137
MboII GAAGA 1 cut(s) 112
MluCI AATT 2 cut(s) 104, 183
MnlI CCTC 1 cut(s) 154
MseI TTAA 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 16
NlaIII CATG 2 cut(s) 68, 73
NspI RCATGY 1 cut(s) 68
PciI ACATGT 1 cut(s) 64
PkrI GCNGC 1 cut(s) 43
PscI ACATGT 1 cut(s) 64
PspFI CCCAGC 2 cut(s) 73, 123
SaqAI TTAA 1 cut(s) 81
SatI GCNGC 1 cut(s) 42
SetI ASST 3 cut(s) 90, 146, 197
SfaNI GCATC 1 cut(s) 137
SgeI CNNG 8 cut(s) 77, 82, 86, 109, 129, 136, 176, 189
Sse9I AATT 2 cut(s) 104, 183
TaqI TCGA 1 cut(s) 131
TasI AATT 2 cut(s) 104, 183
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseI GCWGC 1 cut(s) 41
XapI RAATTY 1 cut(s) 104
XceI RCATGY 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.