RchiOBHm_Chr5g0067171

May play an essential role at the early stage of chromosomal DNA replication by coupling the polymerase alpha primase complex to the cellular replication machinery

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
73335554 .. 73337826
2273 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34290

Sequence Viewer

Length: 210 bp
ATGATGTTCTCTGCTTTCACGTCAAACAGTTGTTGTTCTGTACATATTCTTAAACACCTTTGTGGAGAGGAGACCTTACGTATTCCAAAAGATGAAGAACCTAGCTGTGATCGCGTAAGAAGACTTGCGAACCATACATTCAGCCATATGGGTAAGCATTATCCCTGGAACTGTGTTGATGGTTATGGCTGGAAGATTCAAGGGCAATAG

Protein Analysis

69

Amino Acids

7.99

Weight (kDa)

7.69

Isoelectric Point (pI)

56.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020459)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 114
AfaI GTAC 1 cut(s) 42
AgsI TTSAA 1 cut(s) 200
AjiI CACGTC 1 cut(s) 21
AjnI CCWGG 1 cut(s) 164
AleI CACNNNNGTG 1 cut(s) 60
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
Alw26I GTCTC 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 127
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 65
BfaI CTAG 1 cut(s) 102
Bme1390I CCNGG 1 cut(s) 166
BmgBI CACGTC 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 166
BpiI GAAGAC 1 cut(s) 127
BsaAI YACGTR 1 cut(s) 80
BsaI GGTCTC 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 166
BseDI CCNNGG 1 cut(s) 164
BseRI GAGGAG 1 cut(s) 83
Bsh1236I CGCG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 65
Bso31I GGTCTC 1 cut(s) 65
Bsp1407I TGTACA 1 cut(s) 40
Bsp143I GATC 1 cut(s) 109
BspFNI CGCG 1 cut(s) 114
BspTNI GGTCTC 1 cut(s) 65
BsrGI TGTACA 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 164
BssMI GATC 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 166
Bst4CI ACNGT 2 cut(s) 29, 173
BstAUI TGTACA 1 cut(s) 40
BstBAI YACGTR 1 cut(s) 80
BstFNI CGCG 1 cut(s) 114
BstKTI GATC 1 cut(s) 112
BstMAI GTCTC 1 cut(s) 65
BstMBI GATC 1 cut(s) 109
BstMWI GCNNNNNNNGC 1 cut(s) 111
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
BstSNI TACGTA 1 cut(s) 80
BstUI CGCG 1 cut(s) 114
BstV2I GAAGAC 1 cut(s) 127
BtrI CACGTC 1 cut(s) 21
Csp6I GTAC 1 cut(s) 41
CviJI RGCY 3 cut(s) 105, 144, 189
CviKI_1 RGCY 3 cut(s) 105, 144, 189
CviQI GTAC 1 cut(s) 41
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco105I TACGTA 1 cut(s) 80
Eco31I GGTCTC 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 164
FaiI YATR 5 cut(s) 45, 135, 147, 149, 186
FauNDI CATATG 1 cut(s) 147
FspBI CTAG 1 cut(s) 102
HinfI GANTC 1 cut(s) 196
HpyCH4III ACNGT 2 cut(s) 29, 173
HpyCH4IV ACGT 2 cut(s) 20, 79
HpyF10VI GCNNNNNNNGC 1 cut(s) 111
HpySE526I ACGT 2 cut(s) 20, 79
Kzo9I GATC 1 cut(s) 109
LpnPI CCDG 3 cut(s) 151, 175, 178
MaeI CTAG 1 cut(s) 102
MaeII ACGT 2 cut(s) 20, 79
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MboII GAAGA 3 cut(s) 107, 132, 205
MnlI CCTC 1 cut(s) 61
MseI TTAA 1 cut(s) 51
MslI CAYNNNNRTG 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 166
MvaI CCWGG 1 cut(s) 166
MvnI CGCG 1 cut(s) 114
MwoI GCNNNNNNNGC 1 cut(s) 111
NdeI CATATG 1 cut(s) 147
NdeII GATC 1 cut(s) 109
OliI CACNNNNGTG 1 cut(s) 60
PfeI GAWTC 1 cut(s) 196
Ppu21I YACGTR 1 cut(s) 80
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
RseI CAYNNNNRTG 1 cut(s) 60
SaqAI TTAA 1 cut(s) 51
Sau3AI GATC 1 cut(s) 109
ScrFI CCNGG 1 cut(s) 166
SetI ASST 6 cut(s) 23, 60, 77, 82, 103, 107
SgeI CNNG 7 cut(s) 31, 114, 125, 137, 177, 178, 202
SmiMI CAYNNNNRTG 1 cut(s) 60
SnaBI TACGTA 1 cut(s) 80
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 164
TaaI ACNGT 2 cut(s) 29, 173
TaiI ACGT 2 cut(s) 23, 82
TatI WGTACW 1 cut(s) 40
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 108
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.