Rh1DG443400

May play an essential role at the early stage of chromosomal DNA replication by coupling the polymerase alpha primase complex to the cellular replication machinery

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
65226915 .. 65229514
2600 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG443400.1

Sequence Viewer

Length: 216 bp
ATGCCAGATGATGTTCTCTGCTTTCAGGTCAAGATAGGTTGCTATTCTATACATATTCTTAAACACCTTTGTGGAGAGGAGACGTCACTTATTCCAAATGATGAAGAACCCAGTTGTGATGGCGTAAGCAGACTTGCAAACCATACATTCAGCCATACGGGCAAGCATTACCCCTGGAGCTGTATTGATCGTTATGGCTGGAAGATTCAAGGGTAA

Protein Analysis

71

Amino Acids

8.08

Weight (kDa)

5.86

Isoelectric Point (pI)

51.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020459)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 86
AcyI GRCGYC 1 cut(s) 83
AgsI TTSAA 1 cut(s) 209
AjnI CCWGG 1 cut(s) 173
AleI CACNNNNGTG 1 cut(s) 69
AluBI AGCT 1 cut(s) 180
AluI AGCT 1 cut(s) 180
Alw26I GTCTC 1 cut(s) 74
BccI CCATC 1 cut(s) 113
BciT130I CCWGG 1 cut(s) 175
BcoDI GTCTC 1 cut(s) 74
BglI GCCNNNNNGGC 1 cut(s) 159
Bme1390I CCNGG 1 cut(s) 175
BmrFI CCNGG 1 cut(s) 175
BmrI ACTGGG 1 cut(s) 105
BmuI ACTGGG 1 cut(s) 105
BpmI CTGGAG 1 cut(s) 196
BsaHI GRCGYC 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 173
Bse1I ACTGG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 111
BseRI GAGGAG 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 74
BsmBI CGTCTC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 187
BsrI ACTGG 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 173
BssMI GATC 1 cut(s) 187
BssNI GRCGYC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 175
BstACI GRCGYC 1 cut(s) 83
BstC8I GCNNGC 1 cut(s) 164
BstKTI GATC 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 159
BstNI CCWGG 1 cut(s) 175
BstSCI CCNGG 1 cut(s) 173
Cac8I GCNNGC 1 cut(s) 164
CviJI RGCY 3 cut(s) 153, 180, 198
CviKI_1 RGCY 3 cut(s) 153, 180, 198
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
EcoRII CCWGG 1 cut(s) 173
Esp3I CGTCTC 1 cut(s) 74
FaiI YATR 5 cut(s) 50, 54, 144, 156, 195
GsuI CTGGAG 1 cut(s) 196
Hin1I GRCGYC 1 cut(s) 83
HinfI GANTC 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
HpySE526I ACGT 1 cut(s) 83
Hsp92I GRCGYC 1 cut(s) 83
Kzo9I GATC 1 cut(s) 187
LmnI GCTCC 1 cut(s) 177
LpnPI CCDG 6 cut(s) 11, 18, 124, 160, 184, 187
MaeII ACGT 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 84
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 2 cut(s) 116, 214
MnlI CCTC 1 cut(s) 70
MseI TTAA 1 cut(s) 60
MslI CAYNNNNRTG 1 cut(s) 69
MspR9I CCNGG 1 cut(s) 175
MvaI CCWGG 1 cut(s) 175
MwoI GCNNNNNNNGC 1 cut(s) 159
NdeII GATC 1 cut(s) 187
NmuCI GTSAC 1 cut(s) 84
OliI CACNNNNGTG 1 cut(s) 69
PfeI GAWTC 1 cut(s) 205
Psp6I CCWGG 1 cut(s) 173
PspGI CCWGG 1 cut(s) 173
RseI CAYNNNNRTG 1 cut(s) 69
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 1 cut(s) 187
ScrFI CCNGG 1 cut(s) 175
SetI ASST 5 cut(s) 30, 40, 69, 86, 182
SmiMI CAYNNNNRTG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 173
TaiI ACGT 1 cut(s) 86
TfiI GAWTC 1 cut(s) 205
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TseFI GTSAC 1 cut(s) 84
Tsp45I GTSAC 1 cut(s) 84
TspDTI ATGAA 1 cut(s) 117
ZraI GACGTC 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.